Description :
From Genome Similarity Track
Location :
Scaffold_79:41938- 44749
Transcript NameFunction/comments
Albla_Nc14059460conserved hypothetical protein
Albla_Nc14059470cell 5A endo1 putative
Albla_Nc14059480

Sequence
2811 bases(100 bases per row)
GCGGCAACGAAACCGAAAGGTAAGAAGAAAAAACAAACAGGGAAGGAGGGATACACAAAAGTAGAATATGGGAAGGATGCGGCTGGGATGAACGATTACA
TTGATAATTACGATGATTTTGATCAGTTCGACGAATTTATGTAAAGAAATAGAGTCGTTCCCCAATGGTCCCCATATACTTACTCCTTGTTGGAAATAAT
CTATAATGCTTTTTCAAGACTGCGATAGCTTTGGTTATCTTGATCTCTCATCAGTGAAGCAAGGAAGCTTTCGAAGATGCTGCATGGAATCCATTTTTCG
CAAAGCTTGGAGGTAATTCTCGTCAGCAGTCAACCAATCTGATTTGAGTAAGCCTTCCTTGAAATCTCCATACTCTTCGGGCCTGCTGTACTGGAATATA
CTTTCTGGATTTAAGGACCACACGAAGCCTCCTGCCCAATTTGGGCTACTGATTATATCGATGATTATGTCAATTGTTCGCTGGGCGGTTTTCTTGGGGT
GCTGGTCTCTCGAGTATAGCCCACCAAATTCTCCCATGAGCAACGCGGGACCATGGTCAGAGGCCAGAAAGCCAAACATGCTTTCCATCGTACCCTCAAT
CCGCTTCCTCAGGGTTTTGTTGGAGAGCTCACCATACGCATCGAGCAAGCCTGTCGCCTCATCTCTATTTGGGTGAGAATAGAAATAATCTTGGGGATAC
ACAGATGAGGAATAATAGTGGGGAGCCCAAACTAGTTTTTGATGCTGATTCAAGTGCACACCAACTTCTTCAGCTCCGGCTAAACCACCTCCATACCAGT
CATTGTACTCCATAAGTTTTCCGTCAATAATGGCTTCTCGACTCTCAAATACTCCTTCGACAAATGCGAGCCACTTTGGACAGCCCGAGAGCATTCGATT
CCCAATCTTCTCTGCTGCTTCGACAAAATCTGTATCGGATTTATCACCCCATGTTGCTTGGTATGGTTCATTTTTAAGATCAATTCCGAGCACGTTCCAA
TAATCATCGCTGCATAAGTTCGACGTTAGAAGATCCACCGCTGTGAGATAGTCTTCATAGGAGATGTGTTCATTGTACCAGAGACCACCAGTATCAGCAA
CAGTTAGAGTATGTAGACTAAGAACCACGGCTATTTCGCGATATTGCAAGGCTTTGATAATACTTTTTAGTAACGAAAAGTAGCTGCGGATTGATATCGC
ACGATTTTCACTCCGGTTGATCAAAGTTGGATTGGGTGCTTGGTTCATCAAAATATGCTGAATCATCAACGGCAAACGAATAGAATTAAACTTGTAGCTC
GACAAGAAAGAAGCGATCTGATACTGCAATTGATAAAAATCATCAGTTGATAGCTTATTCAAGATTATTTCCGAAGGCACGTACTACTGTCGTTCCGTTA
TCTGCATTTTGCCATAATCCAAATGGAATAGCATTCAATCTGGCACATGACAAAAACCCGCTCAATTTGGATAAAATTAGAGTGTGATGACATACTGTTC
CATTCCGAACCTAATATCGACATGACTTTAGAAGAAAAGAGCTCCATATGCAGCAAAGAGGCTCACCAATTGATGCCTTTGATCTTGAACGGTACTTCTG
TACCATTATCAGCTATTGCGTACAATTTTCCATTTTTGCTTACATAATTTGGCAACTGGCAAGCTATCAATTGCAATCAGACTCAACCCATTGCCTCGTG
TGATTTTAGGATACACGTGGTACCTGTTGCAGGATACTGTTTGGGATTCCCGATGATACCATCATCCGAAACCAGATCAGGTACATCAAGGCCTACCCCA
CCACGTATTTTGTGACGATTGAATTTGAATCGTCCAGCTCTTCGTGCTTGCTCCAGCCGAGCTTGCCGATTTTTATATGCCCCATATGGAATGAAAAAAG
ACGCAATGCCAAGCAGTAGCACCAATAAGGTCAACCCAGGCCAGGTACGAATTCTTCCCTTGTATTTTGTTGTAGTTCCCAAAGCAGTATGGATATCCTC
ATCATAGCAAGATGCGCGAATGATACCGTTTTTTTCGGTCATTAGGCTCATTGAAGGCCGCGGTGAATTAGCTTCTGTAGATAGGCAGCTATACCGATAC
AATGAGACCATTTCCTTTTCAATTACCTGGTCACGTAAGCTCGGCATCGTACTTTGTTTATCTCAAAGCGAGTATACCGATTTTGACAAGAAAAAGTGAC
CTGAATCCTACTTCCTAAGAGTTCGATTCTATTCACGAGCAAGTCGCAGCGGTTGACTTGGAGAATCAGTGTCGTAAGGCTAACATTTAATGTTTAGCCA
TGACGTGTGTAGTCAACTTGGGGACGAAGTGTATCAGTCTCATACACTTTCTGATCCAGTTGTCACTTCATTCAATATTGACTGATGTAGATCAAGTTTG
CTCGATCAGCTGCATAGTTGCAGCCATTGCAGACTACTGACTAAAAGGTTTTCTACTCACGAGCATATGAAACTTTAGACAGGGTTTGCTTGTAAAGTTG
CAACTCAATTGCTCTCCTTGGCTGGGTCTATAGATTTCGTAAATAGTCTCTGGTGTATTTCCACAGTCTGGCCGATCCATATGTTTGGGCATTCATATTC
ATCACGTGTATGTCTAATTCTCTGCATGGCATAACGTAGATATTCTACAATCACACTGGTTATCGTAGAATAAGCTAGCTATATGTCTACGAGGTCGCAA
GGAGATTGATATACTGTAGTCCATTCAATACGACATCAGATAACATATTTCGTGAATATATCATCACTGGATAATCTATCTCATTCACCTGGCTTATGAT
TCCGATAAAAT