Description :
From Genome Similarity Track
Location :
Scaffold_6:41932- 47806
Transcript NameFunction/comments
Phypl_g267conserved hypothetical protein
Phypl_g268hypothetical protein PHYSODRAFT_293744
Phypl_g269conserved hypothetical protein

Sequence
5874 bases(100 bases per row)
GTCCATGTTGTAGGATTTTGCCAGAGACTGTGTATTGCAGAGGTTTGACGGTGATATGCAATCCAGCTGTATGAAAGCGCACGTCGGGAACGCTCTCTCC
CCATAATACTGATATGCTCTGCTTGTACTGTCTCGAGTACGAGAAAGTTGTTGACCAAAGCACTTGAAGCGAGAAGCACGTCAGCGCCACAGCTGGCACG
ACATCCCATACTCACATTTACCAACTTTACCAACTACCAGTTGCCTGCCGTTCTGCGTCCTGGAGCCACAAAGAATCACAATGACGTGCGTACAATGCAG
ACTTGGAAACGCGTCCCAGCAGTCCAATTCGCAGAGTTGCTGGCTGCGTTTAAGCAGCTTTAAAAAAAGCTTAGGATACCACGACGTTCCGATACGACGA
CTAATGAGGCTTTCCCAAACTTTGTAGTTTTCAGACATCGGCGGAGTGGAGACTGGTACTGGTGGTACAAAACGTGGGGAGTGGATACTGCAATTGAGAC
CCTCGTAGGAGCCGGAGCCGTTGACCAGTACTGTAGCAGTGGGGATCGACCGAGAAGAACTCCCTTTCGACTGATCTGGGGACATCTGAGAGCTCCACAT
GGGCCCCATCCACGTGGATCTGGAGAGGAAGGTCTTTGTTCCGGAGACTGCGATGGCGAGCTGCCAGTTGTTTAAACTGCCTTTGCTTTCCTTGCCCGTG
CTTTTGGTATCGTTGGGCAAGCACCGAcccgctacatgtacatgacAGGTACTAGTGCTCCTTGAACCTGCAATGCAATCTGACATTCAGGGTGGACTGC
GCGACAACGTCTGGGCAGAAACTGCGCTCGTGTCACATGTTGAAGCGCCCGATCTAGTGAATGGGCGTGGTGCTGAATCCTTAAGTTAAGAttgccgcgc
tgctgctgtgggcaCGACCGAAACGCCTTCTTGTCCCAAGTCCTTCTTGACCGGATGACGATCCCGCCGACGCGCGAGTATCTCGACGAGGACTCAGCCC
TCGTGCATCCCAAGCAGGCCGCGTCGCCTGTAAAATCTGGTGGTGCCGTGCTGGACTACAGCAATTCGTACCTGGGGGACGACAAGTTCGCGGAgatcgt
ggagaaggccCGGCTAGCGAGCATCCCGACGCGGCTGGATCTGCGTGGCAATTGCttcgaagctggagctgcacgagcactCGCGGCGCTACTGCGTTCC
TCGCATAATGTGGTGGCCATCAGTCTGGAATGGAACAacgtggggctgctggaccaAGGGGTGGAGGCCCTCGCTAGGGCGCTGGAAGTCGATAAGcggc
tgctgacgctcgacttgcgcaacaacaacattGGACCCGAGGGCGCCAAAGCGCTCGCGAAAGCTCTCCGAGCCAACCGTACATTGCGTCAATTGGATCT
GCGCTGGAATGAGGTTGGGAATCCTGGAGTGTTGGCATTTCGTGAGGCATTACAGAGCAACCACTCGCTTGTGACGCTGGAACTCATGGGgaacaacagc
agcttgaagcacgtggacgagatcgaggtgctgctggcaagGAATCGCGCGCTCACGGAGAGACCGCCAGCTCtcgcggtggacgcgtcTTGCCAAAACG
ACGATGACGTTGGATCGAACAACGACCCCAGAGCTGCTCCGGATGACCAGCTACTGCTGCAAGTCCTAGCCGAgaaggaagagctggagacggagatgAA
TCTAGGCAAGCGGGAGCGACAGAAAATGGTAAGGTGGGGAGCGCAAGTACGTCGTGGTCGTTCTAATGTGCGTTGTATGGTTTATCCAGATAGAGAAGAC
GGAAGAGCTTGAGCTACAGCTGCAACAAGTTCGCAAGGAGACCGGCATGGCAAAGGAAGAACGAGACCgctaccagcagcgcgagatcgaTGCAAAGCGC
GACATCCACGAGCTGAGAATGCAgcttgacgagctcgaaAACCGTAGGAAGCTGGAGTTTGAAGAGTACCGGTCTGCGCGGACAGCACTCGAGCGCGAGA
ATGGCGTTACACGAGAGAAGGTGGGGCACATGGAGGCTCTACGCAGCAAGGAGGCAGAGCAGAAAGACAAGCACATctcgcagctggaagaggccAAGTA
TGCGCTCGATAACGAGGCACACCGCACGTTCCTCACGATCAGGTAAGCCAATGCTTGTTGATCAGCTTTTCGACCACTACTTCGATACTAGGACTTACAC
GTTAGCTgccgacgtgctgggcaGGACGCAAGAAGAGGAAATCAGGAAGCTAcagaagcagcttcaagatGCCCAGCAGGAATATGCCAGAAAAGAAGCC
AAGCTGGTGTCGGACCACGAAGGCAAAGTGAGTGCGgcccagcgacagcatgATATGGTTGCAGGCTCCATGCAGACGCAACTCAGCTACGCCTCCACCC
AGCttgaagcgagcgagcggagcGTACGAGAGCTCAAGGAAAAGTGCGAAGCCCTGCaagccaagctgctgcaggctcaGATCGACCACGAGAAGACCAT
CGGTGATatcaagcagcagtgggAAACCGAGGTGCAGGAGCGCATCCAGCGCTCGGTCGGGTCGGTCGAGGCGCAGGTCGCcgaggtgaagaaggcgcgg
CAACATCTCGAGCGagaggtggagaagcacctCGAGACCATCATCCAGCTCCGTCAGGACAAtgtgtcgctgcagcagtcgaggGATGACacgcagagcg
agctggaggccgtgaTGGAGACgcaggccaaggcgctgcaggagaagcagacgcagctggcTGCAGCGGTGAGCGAGCGGTCTCGcttcgaggagaagct
gcagctccagctgcggAAGATGGCGGAGCAAGACGCGAGACTCGTGCACATGCAGACAAGCTTCGATGAACGGATTCAGGTGCGTCTGCTGTCGGTCTGT
AGCTTCCCCGTGGCGTCTTGCCCCCTCACACAGACGACGTGTGTCCTTTGCCTGTGCTTTACTTGTTTGGATAGGCCCtgaccgccagcgccaagatCGC
GGCCGAGGAGAGCGCCACCGTCTTAAAGGAGagggcggcgctggtcgcGTCTCTGGAGAGCCAAGTGCTGCGtctggagcgcgagctgttGGCACAGaac
cacgagcacgagcagcgcatcgacgacctggccGAATCCTTTGGCCGTTTCGTGCAGGAGCAAATCGGCAAGGAGCGCGCACGCCGCAAGAAACCGAGtt
ccgacgccgacgcctAATAGCGGCTGCAGTGAAGCGGTGCAGCGAGATCGGCGGGAAAATGGCACAGAGCCCTTTGCGCCGGACGGCCTCTCATTGGCAG
GTTTGAATCGGCGCCGGGCGTTGGAAGCCGTCGCCACCAAGTGTTTCGACCGGTTTATCCCGCTGTCCAGACGTTGCCGAGctgcgacgagctgctcgag
tccgGAAAGACTGGAAAAGCCAGCCCTGCGCGCTGAAACCGCGAGCCGCAGGCATGTCCGCTTGCCAGTTGCGCTTTCACCCCGGAGGGCGCACGCGAAC
GAGATTCTGGCAAGTGAGGCTCCGTCGTAGCGTGTTGACTCGGGTAACGCTTGCATCGTCTTAGTCGCTCCACCGCAAACTAAAGCCAATTCAATTCACG
CGCACAATGGACGGCACCTCGAGCGTGCAGACGCTTATCGACCAGTTCGAGCTCATGGCGCAGGCCAACGCAGCCCCGCGCACGTGGTCTGCAACGAGGA
ACACGAAGAGTGTGCTACCACCGCAGCCAAAGACCGGCAACTCGCCACAGCGCGCCCGCACGCAGTCCGAGCCTGTGCAAATGACGCAGAAGACAGAGGA
GCCTGATGCGGAGCCGGCAGGGGAGGTACAGGAGACCCCGGTTGCCAAGCCGACGGCGACTCCGACGAAGTCCGCTGTCTACAAGAGCCTCACGGTGGAC
ACCGCGCAatacgacgacgacaatgacGCCACCTACACGACCAAGTGCACGTGCTACTCGACCGTGCCCCGCAGCCCGTCGACATATTCTACTACTTCTA
CGGGATCACTGGACTCGCTTCTGAGCTCGTTGGACATTTTCctgcccgagctgctgcaggcgacTGGCGAGACCAGCGCTGAGATTGTCAAACCTGCGAA
CTACCGCTCGAGACGCTCCTCGCTCCCTGAAAACCTGCAATCAACAAATACCTCCAAGTTGGTtccgccgtcgtcgtacCGGCGTGCTTCGCTCACCCCA
AAGCAGTCGTCTACCGTAGCGAAAAAGTCGTCGACCAACCCGCGCCGCTCCTCGCTCTACGCCCCCAAGAACGCACCCGCAGTTGCGCCAACCCCGGCGA
GGCCTCGTCGCTCCTCACTTTCGGCCACGATGGTGCCACCCACTGTCAAGCAATCAGCACGCGGTGCCCCACGTCTGGTTGCATCCCCGCGTGGGAGGGG
GCGCTCGAACTCGTCTTCTGTCTCTCGGTTCATGGACTACGACAGCTCACCGCGCTTCGCGGCcaccaaggccaagaaccTGGAACGCCGCCGTCAATTG
GAGGAGCGCAACCGCagcctcgccgccgccaagtcTGCACGGAGGCCGCGCACGCCGGAGTGGCAGAGCCGTCTCGACCGGGTGCGGTCACGTCTGTTTG
ACACCAATGATGACAACCAGGCGCACACAGTCAAGACAAAGGCAACGCGAAGACACTCAACCTCGAGTCACCCCCGCGCCTAAAGTGGACGGCTCGTGTC
GCTGCATCAACCACGCGAGCGTCACGATAACTTGTACCATACATACACTATACCCCCCGAACTGcaactgtagccatcttgcAATCTGCTATGTAGCTAT
CTTGACCCAGAATGATGGTCCTTGCACTTTTCGTGTGGCCCTCAGCTCTTTGTTCTCCCATGACGGCCACCGCATCCTTCCCCATGCCGAGCGGCTACAG
TCTTGCAGCCAGTTACTACTGCCTCAGTGCAAgcggcgaagacgcccaAGCCAACAACATCAGCGAGACCCCGAGGCCGAGTgagacggcggcggtggcc
cCCGAAGATGTTCCGACCGGTGCCGTGCAAGTGCCGCGTCTGCCACTTAGCGAGCTCAACTGGAAGAACCGCGCTCGGTTCCTGGAGATGATGGGGCGCC
ActcgttcgtggtgctcacggACCTGGGCGAGAACCTGGAGCGCACGCACGACCAGGTGCTGAAGGACGTCGAGACGTTCttcacgagcgacgacgagga
ccgGAAGAGCGGCTGCACGAGCAAGCAGGTCTACCTCAACGAAAACGGCAAACCCTTCTGGTACGCCGGGTTCGAGCACACGAGCGTGCGCGACTGCTTC
CGCGTGGCTTGCGGGGACATGTCGAGGCTGGTGTGGCCAACCCCGGAGTTCAAGGACCACTGGCTGtccctgcagcgccgcatgCAGCGCATCTGCGACC
GGGCCCTGAGCTTGACAGTCGGCTACGACATTGTGCCTAGTCACGCACGCTCGGATAAGGACTTCTCCGTGTGCTACGGACTGCACTACCCGAACATTGA
AGGAAGCGGCCAATCGGAGACGGAAAACGTCTTCGAGCATGTGGACCCGAGTCTGTACGTCGTGGAGCCTGTGCCCAGCGTGGAGGGGTTGGACGTGTAC
GACCCACACTCCAAGCAGTGgctcaaggccgagaaggtATGCGTCCCCGGTAAGGAGATTGTGCTCTTCTGTGGCCACGCCTTGAACCGAGCCACGGAAG
GCCGGATCCCAGGAACGCTGCATCGCGTTCGCCGCACCCCAGACCGGCGGTTCTGCATCATTTACGAGCAGAAGTACGAGGAGTACTTCCTTTGATAAGG
AGTACTTCTACTTTCTTTGACTACGGCAGGATGAGGCCGGTCTAACGCAGTCAAGTCTCAAGCATGAAAGATAT