Description :
From Genome Similarity Track
Location :
Scaffold_15:41930- 43275
Transcript NameFunction/comments
Physo_131239reverse transcriptase
Physo_131240hypothetical protein

Sequence
1345 bases(100 bases per row)
ATCATCACATCGCGATCCTCGGCGGATTCACATGTATTATCATTCAGGGAAGTCGGGCTCTCACTAACCACCTTTCGCGACTTCTTGGTCACATATGCAT
AGACGGAAACAGGTAGCTCGTCTCGTACTGGTTTCCAAGCCAGCGAGCGTCCTCGTTTAACATCTTCTCGGCGGCCGGCGGCAGCATTCCCGCGTGTTTA
TTCGGATCAAACCACTGGCGTAACTGGTTGAAGAACTCCTGCATCGGGCATTCTCCGGCTTGGTGCACGTCACCGCAGGCCTTGCACACCCTCAAGCATC
GCTCCGTCGGGTGCTGGCCACCACACTTCTGACACGTCAACTACTTCCAGCAGTCTCCTTCGGCATGGCGACGTGAACCACAGTGGCGGCACCGCGGGCG
GTCGCGTCCCGAGTCGTCGGGATCGAAGTTGCGACGCGCCGGCTCTCCCGGCGGGGTCTGCCCCGCGACGAACAAATTGGCGCGTTCTTCGTCCGCCTCG
TCTTGGTCGTACTGGCGATCGTCGCTGTCGCGACTTTCGCGTTCCGAGTCGTACTCGTCCGACGCGACGTGAATCGCATGCACAGCGCGCGCCGGCTGAG
TCGGCGGGGTCGGAGCCTTTTGGCGGAACTTGTTCGAGCCGAAGAGAGTTTCTTTCTGGTGAGCCAATCCACGTTGTCGGGCACGCAGCTTCTTCTCCAG
CGCCTCGGAGTCGGCGACCTCCATCAGCGTGAGACGCGAGGCGAGTTCGGCCTCCTGCGTGTTCAGCGTCCGGATGAAATGCTCGACGTGTTCGCGCTTC
TCTTCAGTCGTGCCTTCGGCGTATGGGATGTTGGCCCTCAAGCCCGCGACGTTGAGCCGATACAAGTAATCCAGAGGGGTCTCGTCGGGGCGCTGAGCCG
CATGGTAGTAGCGGCTGGCCATTGACACGCCCTTGCCGCAGTACTGCACACGGAATTGCTCCCTCAGCTCGGTCCATGATTTCTTGACCTTCCTGGGCAA
CTGAAGATACCATTGGCGCGCAGGGCCGCTCACCAGATCGCTGAACTGCCTGCACACTTCTTCACCCGTCGTCCCGTCGCGTCGCGCGGCGGACTTCAGA
CGGTTGATCCATAGTCTGGCTTTCTCTTCGCTGGCGTCCCGTCCCGATAACTCTTTTAGCTCGGAAGATGCTGAGAGGCGTACGCGGGCGAGGCCTACAC
CGCCGGCTGTCGCCGTCGAGACGGCGGCCGCGGTTCTTGGCGCTCTGATGACCAAGTCGAACAGGTCATCGGGGTCCTCGTCCACGTCGCGTCGAGTTCT
GGACCTCGTCGAAGAACGCGAACTGACGGACTCCATGGCGACATC