Description :
From Genome Similarity Track
Location :
Scaffold_61:41920- 44526
Transcript NameFunction/comments
Physo_138174hypothetical protein

Sequence
2606 bases(100 bases per row)
TTATGCAAGTACGTGAAGGACTACGCGGGCATGATACACCCGTTGTCACAGCTCCTGAAGAAGGAAGCCGAGTGGATTTGGATTGCTGAGTGTCAGCAGG
TCTTCGATGCAGTCAAGCAGGGCTTGACTGAGACGCCGATCTTGGCGGTGACCGACTAAGATCGCCCGTTCCTCGTTGTGTGCGACGCATCCGACTTCGC
AATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTGGTCTACTACCAATCGCGTCAGCTGAAGCCAGTTGAGCGCAACTACCCGGTA
CATGAAAAGGAACTCCTTACCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGC
TGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCAAGATGGCTATCATTCTTCGCAGAGTATAACTTCCGAGTTGAGTACAAACCCGGAAG
ACTCAATGTGGTGGCCGACGCGCTCTCGCGTTGACCTGACTACGCCACGACTGATGCAATGCCATTGACACCATGCGATCGAGCCCCCCAACGTCATCAC
TTTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGGCGCGAAGCTCTTGCTCGCCTACGGCTCAGCGCCATCTGACAAAGCTCGTCAGAAGCTGGC
GAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTAGACGACAACGCGGACCGCGTTGTCGTGCCCAAT
GACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGGGACT
TCTACTAGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTCTCAACGTGTGAAGCCTGCGCCTTTCGCGCCGGCTCCCTTGCA
GTCACTGCCGACTCCGTCGGAGTGTTGGCGGTCCATGTCATTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTT
GTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACC
ATGGCATGCCGATCGACATTGTGTCGGATCGGGACCCGCGCTTCACTGAACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTC
GACTGCGGACCATCCGCAGACGGACGGGCAGACCTAGCGCATGAACCGCGTCCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGC
GAGTGCCGGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATTCGCCGTTGTACGTGAATGTCATCAGGCACCCACGCCTCC
AGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTCCGACTGCAACGCAGCAGCCGAAGACTGCCGCTGACACTTGCACAGTGTCAGC
CGCGACCACGCGCAAGAAGAAGAAGAAGACCGCGTCTGTGCAGAGCACAGACGCCGGCAAGAGCAAGAAGAAGAAGAAGAAGAAGAAGTAGAACGGGTCT
GTTCAGGGCACAGACACCGCGAAGACGACCGCAGAGGCCGGGCCTACTGCTGGAAACGAGCTGAACGAGTTCAGCTCGGACACAATCAACTTCATGCAGC
GCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTTGACCGACAGAAGCTGAACGCAGACGACGTTGGCAGGGGCAACACAAATGA
ATTCAAGAAGGGTTCATTGGTTTTGTTAGCTACTCAAAAACCTGCCTAAACATGCCGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCGTCGG
GTCGTTGACTGTGCTGACACGGCACGGCAACACCTACACACTGGACATACAGTCTAGTATGCGCCTCCATCTGAAATTCTACGTCAGACGGCTGAAGCCA
TACCTGCAGTACGAGCTACCTAGCTCGGCTGAACCGAAGCAGAAGACTCGGCGGAAGGCATCGTCCTCTCCAGCGCGAAGTCGCACTGGAGCAGCGGTTC
GAGCTAATGGTCCAGCTCGGCTGGAACGATCGAGGTGGCCTGGGAGGCCGCCGCAACCTGAGGATACTTCAGAGCGCTGGTTCCGGTCGTGGAGTGACGC
GAGATCAGGGTCAACATCAAGTTGACCACACACGGGGCGTGTTTCCACGATCACCGCCGCCAATTCGTGACGCACACGGCTCAACTCGATGGATAGTTGA
GCGGATTGGTGGTCACAGTATCTCGAGAACAAACAGGCAACCGGTTCGTTTTCGTATCCGTTGGAGAGGATTCCCTCCCAAGATACATGGGAGCCGCGGA
ACGTCTTGCTCGAAGACGTTCCGGATATGGTGAGGGCGTACGACGTCCACCATGCGCTTCACACTGGAAAGTAATACGAGCACTGTTGTTAACAACAGCG
CCCGAA