Description :
From Genome Similarity Track
Location :
Scaffold_243:41910- 45925
Transcript NameFunction/comments
Hyaar_Emoy2813112hypothetical protein
Hyaar_Emoy2813113hypothetical protein

Sequence
4015 bases(100 bases per row)
GTTGCAGGTGTGTTAAAAAGCAAACACTGTATATGTTGTTTCCTCCGTTTCATTGTCCCAAATCCAGCGATTTTTGCTACAATTTTTGTCCTTTTCATCA
AGATAAATTTAGAAAGGCAAAAGGAAGCCAACATATGCTACCCATCGTAAGGCACCAAATCTATAATATGATACGAATGATTATTTCAAACTATAGATGT
CAACCAATTTAAAGGCAAATTAGTGTAATCGATCCTAAAGACGCATCAACGTTAAGCTGCAATATCGACTTACTAAAGGCGATTCAGCAATTCGGGCTCG
AATAGCGGTGTTTGCCCTTTAATGAGCTGTTGTTTGAGCTTTCAACCGTGACAATTTGTGGCCTGTCTACCTTGCGATCAATGTCGGTGTAAAAATCTTC
AAAAATGATGGGTTTGAAGTGCTAGCTTAACGGCGTGCAGTTACCGAGTGAATTCGTGACCAACACCGGACCGGCTGAAGAGCTCAAAACAAGCTTTATT
TTGACGTGCATTCAGCCGCTCAGGGTATAATTTTTAATGACTTTACTGTCGCTTTTTCCCGAAAAGGGACAAACGTGTTAAAACGGATGGAGTAATTCAG
TTATCTGATCCCAGTTTGGCGGTACAGCAAAATTAAATGAGGGATACTCGACTGTACTCTAAATTTGTAGAGGCCTGGTGACAACTGCACAACGCCTATT
GTGTTAATTCTGACGTGTTAAATAACATTTGTCGCTCTGCATGTAACGATCGCGATATTCATAAGATGAAACTTAAAAACACCACTTTCTGCCTAAAAAA
CACCACTCTTGCCTATCTACGCACGATTCATACCGGCTATATATTTGTCTTATACATTCTATGCCAGCGGTCGTTAAGCGAAAGGATGTTTCAAATGGAG
CCCAAGTGCCGTCCACCGTAAGTGGAATAGAAACGCTAGCCCGCGCGTCAACCATTATATCCTTCTATACGGACATAGCGCACCAGGGTTAATGTCCATG
GAGGATTTGGTACTGAAACATTGCCTCGTCGTGATTGAGATAGTAACTACAGTGTATATCGACGACTTAAAATATATGGAATGAGGTACAAGCATCTAAG
GAATATGACAACCTGCCCCTAAGTCCAAAGCTATAAATTCCGTTCGTTCACCTGAATACGCTCATGATAATCAGTCACGCCAAAAACTACTTTTCATCTC
GCTTCGGTAATTCTTTTAAAGCCTTAATGTCGCGTACCCTTGCACATTTTTTGTTACCGTAAAGCAGATATAGTATATTAAATCTTAGTCGACTTTTGCA
TTGATGTCTTCCTATCCTCATGGATGAAGTGCCACCTCTACAGCGTAAATCATACTATTTTTATGCATCGAGGGTGGCCTCCATGGCAGTCATGCAAAGA
GAGCTTAGCCCAAGCGCTCCCTTCTGGTGCGTGCTTGTTGCCTATGAATCCTCAAGGATTGGTATGGCCTTTCGCTTCATGATCACTAGCATAGAACAAT
TAAGATAGATATATAGCCGGTATGGGTCGTGCGTAGATATGCAAAAGTGGTGTTTTTAGGTAGAAAGTGGGGTTTTTTAAAGTCTCTCGTTCATAATCTT
ACTCGTGAGAGTAACAGGCTGTCTTTATCACCTTTACGGTTTACAAGATTGCTGAAAAGTCTCTGGACGCTCGAGCACCCCTACTGGTGGTGTGAGCTGC
CGTCCAGGGTCATATTGAGTTATCTGTCGCGGAGAAACCGGGGTGAAAAAGAGTTCTGCCGCTAGCCGGAAAAAATACAGTCGTCCCCGTCGCGGTTGAA
CCTGTGTTCCCTGACCACTACAGCTTGTAGCTGTCGAAACAGTGTTTGTCGTAGTTCGGATTTCGCTTGGTTGGCGGTTGTTTCCTCGTGATTGTGCACC
CAGCGGTTCCGCTATGCCCATAGGGTGGCGAAGCAGATGGAGCACGCTATCCACCAGATTCGTACCCAAGCCCTGCCGATCTCCTCCGCCGTGTCCGGAA
ACAGGCGGCCGATCTCCGCTCTGACGCCCGGAGGTAGGTCTGGTGCTGTTCGAGATAGCACTGCTGCTTTGTACGCGAGTAATTGGGCGGGCTGGACAAC
CATCCGGGTCCAATGAGTCACAATATACGCCCAACTCTTCGCCGCTCCCTCGCAGTCCCAGATAATATGAATAATCCCTTCATGCTGTCCTCGACAAGCC
AGATAACGTGTGGCATGATGAGTCTTGTGCTCGTCCCGGCTAGTATAGATTTAATAAATAAGCTAACTCGTCAGTGCGCTCAAACCCATTCCTCGTTAGA
TGTGTCATATCCAACCATTGCTAACTAACCAGCCGGTTCTTCTTACCGCTTGTCAACATCAACTCGCAAGTACAGTCTTCCCTCCGATAAGTTATGGGTA
CGATGGACGACAATCACCATAACTTAGCAGAGGTTATAACTTATTGATTTTTGTGTACTGTACATTAGGAGAATCAATCAATTGAGTGATCAAAAAAGCG
GACCTAGGCACCCAAACCAACCCCCCACTTCCCTTAAGTACAAGCCAAAATCCAACCCTAAGGCTTTTACTGCTGGAACAGAACAAAATTCTCAGGCTCC
TGGCTATTTTGCTACCTTCCCAACGGTATGAGACGCACCCATACCTTCTTTCGTCTGAGCTAACAATTATTACACAGGGAAAGCCACATACATACATTTT
TTAACCGTGTCTTGCCTGTTGGTGTGATATCTGAGCAGTATAAAATGTCGCAGATCCGTCTTACCAATGGACAACGTCTGCAAATATGCAAACACAAAAA
GAGAACCCAGATTTATCTCAAACAGCACTGGCGAAATGGGCTACGATGGAGTTCGGCCTTGTCAAAACGCTGTCACAGGCATCAATCAGCAAGATTTTTC
GAAAGTGGTCTAATCTGGAGAATATGGATCCAAGCAGTCTAAATGCAAAGCGACAGCGACTGGTTCAACATCCCATACTGGAAGAAGCTGTGTCTCTTTG
GGTCCTGCAATGCCAACACCGCGGAGTGATTATCACCGCGGATATCATCTGTGCGAAGGATCATCGGCTTGCTCAACTGCTTGGTACTCCTGACGACGCC
ATCACTTTCTTGCACGGATGGCTTCATAAATTCCAGCAACGTCACGTGCTCCGCACTATCAACATTTGCGGTGAAAGCGGCTCGTTGGACGTGGAGGCTA
TGAATAAAGCTCTGTATGATGTAAAGAAGGTCATCGCAGAGTACGCACTGTGTGATGTTTACAACATGGATGAAACCGGTAATTTTGTTTGTTTTATTTC
TAATTGAAACCGAGTCTGACAAAATTAATTTTCAGGACTATACTACAGCATGACATCTGACAGGACTACTGCACAGCAAGAAATTGAAGGACACAAAAAA
GACAAGGTGAGTATATTGCAGAATGCTTGTTGCCATATACTAACACAGGGGTATGCACTGACATCCTATGCAGTCGCGGATTGCAATTGCGCTCACTGCA
AATACTGATGGCTCTGACAAGCTGCAGCCTTTCTTTATCGGGAAAGCCAAGAAGCCCCGCTGCTTTGACAAGAAATCAGGTCAAGCACATGTATTTCTCT
ATCGCAACAATACAAAGGCTTGGATGACGGGCGTGTTCTTCCAGGAATGGCTTGCAAATCTAGACAAAACAATGAAGGTGCGTAGCTATTTGAAATTAGA
AAACTTATTATTCTAGTATTGTATTATTTAGATCAAAAGTAGAAATATCCTTCTATTGATTGACAATGCTCCGTCGCATATGACGAATGACCTTACGTTA
ACTAACGTCAAGGTTCAGCTGCTTCCACCACGTATGACCTCCATGATTCAGCCGATGGATGCTGGTGTCATCGCAGCGTTCAAGCGGCGGTATCGCCGTT
ACCATCTGCAGAATGCGATCGACTGTGACGAGCGTAGGGAGAGTTTTAACATCTACAAAGTCGACCAACTTACTGCCATGCGCTGGTCGGTGGCTGCCTG
GAACGAGATTTCAAG