Description :
From Genome Similarity Track
Location :
Scaffold_2009:4191- 5253
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2009-snap-gene-0.4Subtilisin-like serine protease

Sequence
1062 bases(100 bases per row)
TGCTCGCAAGCGCCCCACATCGTGAGCAACTCATGGGGTGGCAACCCGGGCAAGACGTTTTTTGCGGGGGCGGTGAAGGCGTGGCGCGCGGCCAACATCA
TCCCTGTCTTTGCCAACGGCAATTCGGGCCCGTGGTGTTCGTCGACTGGATCGCCGGCGGACTTTCCCAATGTAATTGCCGTTGGTGCCACGGATTCGGA
TGACAAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGTTCGAACTTGACTCGGGAACGTCCATGGCAACGCCGCACGTCTCGGGCGTCATCGCGTT
GCTGCTGAGTAAGAAGTCGACGCTCACGTACGACCAGGTCTTGTCGGCCCTTGGGAGCACGACCGAAAGATCGACGCTCAAGCGAGTTTATATGAAGTGC
AATGGCACAGCCGAGACGCAGTTCCCGAACAACCAGTACGGTTACGGGCGCGTGAACGCCTTCAGCGCGCACAAGTCGATCGCCTAAGTCTTNNNNNNNN
NNTGCAAGACATCGTAGAGGGCGTCATAAACCGCCGACTTCGCATTTGACATGGATGGGGCCGCAGTTCACACCCTTGACAGCGTGCGTGGGAAGAGTAC
TACGAAGTTTGCTCGAGCAAAGCCGTCGTCGGTGAACTCGAGGCCAAGCGCGCGCCATGTGGAGCGGAGGGCGTTCCAATCAACTCTCGTAGCCTCAACG
CGGCCGCGGGAGAGTGGGGGCAATCGAATCGTCCATTGCACCCGTCCCAACCGGAGATGCGAAGGATCGGCACTGTATTGCCGCGGCCGCGAAATTAATT
TGCCGATCGTTAGGAGGCAGGGGCGGGCCTTCGNNNNNNNNNNTTATAGCCCCATGCATGAATCTTTGGTGGCCTCCCGCCGAGCATAATCCCAAAACGA
GTACTGTATTTGCTGTCATGCCACGGCTCTGATTTAGTACTAGCATCATCATCCATTGCGCC