Description :
From Genome Similarity Track
Location :
scaffold_27:41906- 43360
Transcript NameFunction/comments
g1353.t1 nucleolin, putative

Sequence
1454 bases(100 bases per row)
GGCCACCACGTCCACGGCCACCGCGACCACCGCCGCGTCCCCCGAAACCACGGCCGCCACCACGACCACCGAAGCCACGGCCACCGCCACGTCCACCATC
GAAACCACCACGACCTCCACGGCCGCCGCGGCCACCGCCACGGCCACCAAAGCCACCGCGGCCACCACCGCTGTGCTGCTCACGCGACTTGGCGTAGTTG
ACACGGATAGCACGGCCGTTCACGTACGAGCCAGCAAGCTTGACGGCCTCGTCAACAGCCTCAGTGGTTTCGAAGTCCACGTGACCGAAGCCACGGAACT
CACCAGTCTCACGGTCCGTAGCAAGACGGCAGCTAAGGATCTCACCACATTCCCCAAAAGTCTCACGAATGGTGTTCTCATCCACGTCCCAAGAAAGGTT
GCCAATGAAGACGCTGGTGCATCCCTCCGGCTTCTCGTCAAACATGTTCTTCTTCTCGGCCGTACGGATCTTCATCCAACGACCACCGAAGTCCTGGCCG
TCCATAGCAAGACCAGCCTCCACAGCCTCAGCGGTAGTAAAAGTCACAAAAGCCGTACCAGACGAGCGGCCGTTCTGCAGGGGGATACGAGCGGCAGTCA
CTTCACCGCAACCAGCGAAGTGCTCCTTCACCTCGTCCTCAGTGGCAGACCACGGAAGACCAGCAATGAAGATCTCAAGAGTCTTCTGGGGGTTGGCCAC
AGCAGCAGCGTCGCCGTTCTCCTGCTTCTGCACCTTGTTAGACGTCTCACCCGCGTCCGAGTTTTTACGCTTCTTAGCGACAACAGGGGTTTCCTCCTCA
TCAGAAGACGAGTCAGAGTCGCTCGACGACGACGAAGATTCCTCCTTCTTGGCAGCAACCTTCTTGGCAACAGGCTTCTTAGCCTCCTCGTCATCCGACG
AGTCCGAGTCCGAAGACGAACTGTCCTCCTCCTTCTTAGCAGCCACCTTCTTGACAGGCGCGGCCTTCTTCTTCGGGGCCTCCTCATCCGAGGACGAGTC
CGAAGAGGACGAAGAGCTCTCCTCCTTCTTAGCAGCCACCTTCTTGACAGGCGCGGCCTTCTTCTTCGGGGCCTCCTCCTCATCCGAGGACGAGTCTGAA
GAGGACGAAGAGCTCTCCTGCTTCTTGGCAACAACCTTCTTGGCAACAACCTTCTTAGCAGGCGCAGCCTTCTTCTTAGGAGCCTCCTCCTCGTCTGAGC
TCGAGTCCGAAGAATCCGAAGAGCTCTCCTCCTTCTTAGCAACAACCTTCTTAGCCACGACCTTCTTGGGAGCCTCCTCTTCATCGGAAGAAGAGTCCGA
GGACGAGTTGTCCGAGTCCACGGGCTTCTTCGGGGCGTTCTTGGAGCCCTTCTTCGCAACCACCACCTTCTGCGGCGCCTCGTCGCTGCTCGAGTCCGAC
GAGCTGTCGCTGCTGGACGCAGGCTTCACTTGAGCTTTCACCTTCTTGGCCATT