Description :
From Genome Similarity Track
Location :
Scaffold_14:419033- 426178
Transcript NameFunction/comments
g1248.t1hypothetical protein
g1249.t1XP_009518024.1 hypothetical protein PHYSODRAFT_475850 [Phytophthora sojae
g1250.t1ETL81242.1 hypothetical protein L917_18383 [Phytophthora parasitica
g1251.t1XP_009518027.1 hypothetical protein PHYSODRAFT_353780 [Phytophthora sojae
g1252.t1hypothetical protein

Sequence
7145 bases(100 bases per row)
TGTCCACATCTTTTCGAATTTGCTGCTTCACGAAGTCGGCACGCTGTCGCAGTGCTTGGTTGTCTGTCTGTGGACCAGCGGGAGCGACAACGGGCACTAT
TGCTAGAGAATTGAATAGGGTCTCACGATAAACAAGCTCCACCTCTTCTTTTCGTGCCTCCTTATACGCTGTCCACTGGTACTCCATCGGCAAAAACCTC
ACGTAGTGAAGAATCGATGAGATCGACAACTTGCGAAGGCGCAGCTCCTTTAGGATCGAAGGACCGAGCAAACTTCCCAAATACCTGAACATCTCCTGGA
TACGGTCGACGGCAGCGTCATTCGGCACAGGAATCGCCGGAGCTTCACGAGGCGAGCTTGTTTCACGAGGCGAGCGAGGGGTTGGAGCCCCAACGCCGTC
ACTGCTGCTCAGTTGCTTACTGAGTTGTCGAAGCAGTTTTGGCTTGCCTTGGACATGCTCCTCCACCAGATTTTCAATGACTTCAAAGGTGTCACGCGTG
TCCAGATACAGCTTGGCGGCCGGGTGCATTCTCGGGTTCACATCGCCACCAGGCTTCGCCACGCCCCCCGCCAGTTCCACTAATCGTTGAATTTCTTCCA
GCAGCTGCAGCACCACAAGTTCATCTCTCGAGACTCTGCCGGCCAGTGCCATTTGCAGCAGCTTCCAAGCTCAGAAGCCGATGAAGTCGTGGGAATGAAC
TGCAGGTTGTCAGTGACTGCGCATCGGCTGATCGATCGATCGATCGCTCGAATCGATGGATCCGGTGGGCGCACACGGTCTAGTCACCGCCGTAGATAGC
TGTTCTGGCGCCGTGCTCCTTCTGTCGTAAGATAAACTAGCACGCGACGATTATTAGCCGCCGCGCTATTGCTGGAGGAGGTCAACGCAACGGCTCGCCG
AAATAGACAGCAAGGGGTGTGCGGCTTGTGGGCTACATGACCAGCAACGGCGACCACCTGGACGATAACTTGGTCAATGCATCATGGTTGCTCGAGCTAG
AACGCACGAATAGCTCCTGTACCGGTACCGGCGCAAAGCTGAGCTAAGCTGAGCTGCATCGGATCGGATCCCGTCGAGGTGTGGCTCTCGAGAAAACTTT
CTTCTCCGGCAAAACTGGGAGCACTCACACTATGTCGCAGCACTATCGACACCTACCTAACCGAGTCACTATAATACATGCATCGCAACCGAAGCCGAAC
CTCGTTCAATGCCAACGCAAGGCTTGGCCTGGTTTACAACTCCACGACAAATGGCTACAACTGCAACAAGATGTTCAGCAAAAAGTTCTAAGTCGCTTTG
GTGACATTCTCCCCCTCAACTAGCAACCATTGTCTAAAACTTCGAAGTATTCCGGAGGTTTTTTCAAATATAGGTTTTTCACGTTGCTAGTTTAGGATCG
CCAAACTGGGGGCGCAGACATTGCAAACTTGACAGACGCCACCATGAGCGACGGCATGGGGCTGGGACTGGACCTGTCGGGGCTGGGTCAGGAGACCTTG
GCACCCGCCGTGGACGTGGCACAGCTCGCGGAGGCCATCCGCCTCATCCTTAAGGACGCGGACCTGGAGCAGCTCTCGCGCCGCATGATCCGCAAGCAGC
TGGAGGCGCAGTTCCACGCCGACCTGTCGGGCTACAAGGACGTGATCAACGCCACGATCCTGGAGATCATTGAGCAGCAGCAGGCCGACGAGGAGGAGGA
GGAGCACGAGCCCGACCCGAGCGACGACGAGGACGCCGACGACGAGCAGGAGGAAGAACGGACGCCCCGGAAGAAGGCGGTGCCCAAGAAGAAGAAGACG
CCGCCGCCCAAGAAGCGCAAGCGGAAGGCGGAAGGTGAAGAGGGCAAGAAGACGCGCGGAGGAGGCTTCAACGCAGAGCTGTGTCTGTCCCCGGAGCTCG
CGCAGGTCGTGGGGGCTGACACGATGGCGCGGCCTCAAGTTGTCAAGGCACTGTGGGCGTACATCCGCGAGCACGACCTGCAGGACCCCAGTAACAAGAA
GAGCATCCTGCTGGACGACACACTGCGCGGCGTGTTCCAGCGCGACTCGTTCACCATGTTCAGCATGAACAAGTTCGTCAAGCGCCACGTGCGCAAGCCC
GACGACATGCCGGCGGGAGGGTGGAGCCAGATCCCGCGCGACGGCGTCTCGAGCGACGAGGACACAGAGGCCAAGGCCGCGAAGAAGAAGCCCGCCAAGC
GGAAAAAGAAAGCGACGACGACCGAGGACGACGATGGGGAGAAGAAGAAGACGAACCCGTTCAACATGGAGCTGTCCGTGTCGCCCGAGCTGGCTTCGCT
CGTCGGCAGCGATCGCATAGCGCGGCCGAAGATCGTGCAGGCGTTATGGGCGTACATTCACGAACACAATTTGCAGGACCCGAACGACAAGCGCACGATC
CTCTTGGACGACAACATGCGGAGGGTATTTCAGCGGGACTCGTTCACGATGTTTAGCATGAACAAGTACATCAAGCGCCACGCGCGCAAGTTCGCGGACG
TGCCGCCCGGCGGCTGGGCCGACATCCCGCGCGATGGACTCTCGAGCGACGAGGACGAGGCCAAGGCCAAGAAGAAGGCCCGGAAAGGAAAATAAGACGG
GTGGAGGATTCTACAGACAGGAAGGCAGAGCGGACCAGACAGAGAGGAGCTGCGGCCGTGTAGAAGCAGTAACGCTATCGAGATGCAAGCGGCTGTATCT
GGTACTGAAGTATTTGAAATCGACGTGACGCTTTTGTATGAATGCGGTCCACAAAAGGCACTTGGGCGGCCATTAGCTATGTCTGGGCGTTGGTTGCGTC
CAACGTGAGGTAGAACCCCTCGGAATAGTGGCTTTGCTGAAAAGTGCTACTCTTCCATTTTAGTGACCATTTTGACTGGATCACGAAAGGGTAGCAACTC
TACTGGCGCAGGAGACAGCAGAGACAGCCATGGACGCGTCCGTGATCGCCAGCTTCCGCACGAAGGTGGTGCAGAAGCCAGAGGTGTGTGTCCTCAATGT
CTTGTTGATCTGTCAGTGCGGCGCCGTGCGGAGCCACCGAACGCTAACTGTCGAGTTGTTGTGTTTCTGCTCTGCAGCTATTTTTCACGCCGTCGGAAGA
GGTTGCAGCGGAGATTAAGACGTTCGCTAAGCATGCGTTCGATCGCACGTCCAAGTACCAGAGCAAGAGCGGTGGCGCTTCTCCGCTGGAGGAGCTGTAC
GTGGACGGTTTCGACGCCGACCAGATCTGGGAGCAGCTCCGCATGTTGAACGGCCCGCTAGTGACGGAGATGACGCAGCGCATCCGCACGTTCCACAAGA
AGTCGGAGAACATTTTGCTACTCCCGTCGGAGAAGCAGGAGGAGGACGCAGAGGAGGAAGAGGAGGACGTGGACAAGCTGGAGGAGGAGCAGGCTGACAG
CGATGAGGAAGAGGACAACGACGAGGAGGACGAGGAGACGGCTGACTCGGACGACGAGGTAAAAGAAGTGAAGACCAAGTCGAAGAAGAAGAGCAAGAAG
ACGCGCGACGTCGCGGAGGACGGTTTCTTTGACTGGGACGAAATGGACAAGGCGGCTGAAGAAGAAGAGGAGGAGGAGGAAATGGAGGGCGACGAGGAAG
GCGAAGAGAATGACGACGACGAAGAGGATGATGACGATGACTCTGAAATGGAGGAGGGCTCGGATGCTGAAGCTGCGGAGGAAATTCGCTTTGACGACTT
CTTCGGAGACGAGGAAGTCGAAGTCGAAGAGGGCGACGAAGAGGAGGAAGAAGAGCTCAATGATGTCGACATGAAGGAAGGCGACGAAGACGAGGAGGAG
GAGGAGTACCCGACGATTAACCGTGCGAAGCCTGATGAGGAGGACGTCGACTTGGAGGAGCTTGCGGAGCGCGGCATCATGTCATCCCACCAGCGTCGGC
GCCAGCGTCTTCAGAAGGAGATTAAGCAGTTCGAAGACGAGGCTATTAACGAGAAGCCGTGGCTGCTGAAGGGCGAGGTGCGCTCTGCTGCGCGTCCGGA
AAACAGTTTGCTGGAAGCGGTGCTGGACTATGACCGGCCAGTGAAGGCTGCACCGGTGATCACGGAGGAGGTGTCTATTGCGCTTGAGGAGATGATCAAG
AAGCGTATTCTGGAGGACGACTTCGACGATGTGATCCGTAAGTTCGCTGGCAACGAGGAGGACCAGAAGAACAAGCTGGAGGAGGTGTCCATGGAGAAAT
CCAAGGAGGGTCTGGGCGAGATCTACGAGAAGGAGTACATGAAGACTGCGATGGGCTTCGAGGCCGACGACGAGTCCAAACAGGACCAGGAGGAGATCGA
GGTGATGTTCAAGAGTTTGTGCTGGAAGCTCGACGCGCTGTCGAACTACCACTTCACGCCCAAGCCGGCTGTCAAGGAGCTGAAGGTCAAGCCTGCAGTG
CCCGCCATCGCGATGGAGGAGGTGGTGCCGATCAGCGTGAGCGACGCGAACCTGAAGGCGCCCGAGGAGGTGTACGAGAAGAAGCGCAAGCGCGGCGAGG
CCGTGCTGCAGTCCAAGGAGGAGATGACCCAGACGGAGCGCAAGGCGCTACGCAACGCCAAGAAGCACGCGCGGCGGAAAGAGAACCGCCAGCGCGAGTT
CGACGAGCGGTTGGTGGCCAAGCTCAACCCGGGTCTGGGCAACAAGTACGAGAAGAAGAAGATGCTCGAGAGCATCGCCGGCGCCAAGAACATCACCACG
GGCAAGCAGATCGAGGGCTCGTCCAAGCAGTTCTCCAACTCGAAGGAGTTCTTCTCCCGCCTGCAGGTGCGCAGCCATCGCCGCTGTGATTGCGCCTCGC
CGGCGTGTCACCCTGTTCCCTGGCATGTGCTGATCGTTTTTTATTTGTCGTTGTCATGCAGGACGAGGTTCAAGAGAAAATCAGGAGCGCCAGCGCGAGC
GAGAGCAAGTAGAGCGGACGTCATCAGCATTAAGCGGCAGCTGGCAGCGCTGCAGAGCAATAGAATGGATTTTGTGCATATTGTACGTCGGCCCCGTTTT
GCCCGCCTCCGGCTGAGCAGCAAAGCGACCACGATGCGAATTGCTCGACGCAGTTGTAGTGACCGTCATCTGCCGGGGCATCTCTTGCCAATCCTGATTT
GCGTGGGCAATTTTTTTTTAGAAAGGAATCTTGCGATCATTTTTATCGGGTTGCACTTGTCACGGACGCATGTCAAAAAGATCCCATTCTCCAAGTTGCT
GGCTTCTACGCAAGACCTTTCCCATCAAACGACACCATGCAAGTGAGCACGCGCAAGTACTCGGGCGACGCCAACGACGTGCAGCTGGAGACGGAGGCCG
TGTACGGCCACCCGCTCATGTGCGCCAGCCTGCCGTCCGACGTGTTCCCGCAGCGGTCGGTGCCCGCGCGCGTGGCCCACCAGCTCATCAAGGACGAGCT
GGCGCTGGATGGCAACCCCAAGATGAACCTCGCCTCCTTCGTGACCACGTACATGGAGCCCGAAGCCGAGGACCTCATGATCGAGGGCCTGCGCAAGAAC
TACATCGACCTGGACCAGTACCCGCAGACGGCCGAGATCCACAACCGCTGCGTGACCATGCTGGCCAACCTGTACCACGCGCCGCTGCAGCCCGGCCAGC
AGGCCACGGGCACGGGCTGCATCGGCTCGTCCGAGGCCATCATGCTGGCCGGCCTGGCCATGAAGCGCAGATGGAAGGACCGCCGTATCGCCGCCGGCCT
GTCCTACGACAAGCCCAACATGGTCTTCGGCTCGAACGTGCAGGTGTGCTGGCACAAGATGTGCAAGTACTTTGAGATCGAGATCCGCGAGGCCGACGTG
TCTCCGGACTGCCTCGTGCTCACAGCCAAGCGCGCGCGCGCGCTCCTGAACGAGAACACGATCGGCGTGAGCGCCATTCTGGGCAGCACGTTCAACGGCG
AATACGAGGACGTCAAGTCCATCCACGACATGCTCGTGGCCGAGAACGAGGCTAACGGCTGGAGCATCCCGCTGCACGTGGACGCCGCGAGCGGCGGCTT
CATTGCCCCCTTCATCAGCCCCGAGCTCGAGTGGGACTTCCGTCTCCCGAACGTCAAGAGCATCAACGTGAGCGGCCACAAGTTCGGCCTCGTGTACGCT
GGCATGGGCTGGGCGCTCTGGCGGGAGCCCGAGGACCTCCCCGACGACCTGGTGTTCCACGTCAACTATCTGGGCGGAGACCAGTCGTCGTTCACACTCA
ACTTCTCCAAGGGCGCGGGCAACGTCGTGGCCCAGTACTACAACATGCTGCGCTTCGGATTCGATGGATACCGCCGTATCATGGAGGCTAGCATGGAGAA
TGCGTTCCTTCTGCGTGGAGCGCTGGTGGCGACGGGCCACTTCCGTATCGTGGACAAGCAGCACATGCCGCTCGTAGCGTTTGCACTGATTGATTCGTCG
CGGTACACGTGCTTCGACATCCAGGACAAGCTCAAGAGCCGCGGGTGGATTGTCCCGGCCTACACGTGCTCCAGTGGCGCCGAGGCGCTGACGATCATGC
GCGTCGTGGTGAAGCAGAATTTCTCGTCGCACATGGCCAACATGCTGGTGCAAGACATCATGAAGGCCATCGAGGCGCTGGAGAAGCACCACATCCTGGT
GGACACGGCCATGTCGTCGCCCAAGGCGCAGAAGAAGCACTTCAAGGACATTGTGCACTCGCTCCAGGCCAACCTCAAGCACCAGCAGTCTGGCCTCACA
ACGCACGGCGTGTGCTAGTTGTACTGACGTCGGTGCACGCTCTGGAAGCTGTTGTGCGGACACGTCCAGCACGACGTTTCCGATCTCTTTTTTAGTTGTT
CCTTTCTGCGTTGCCTAGAGAGTGAACGACACGCAGTTCACTCTCCCAAGGAAAACAAACATAACATGCAAGTATTCGACACTGTGAGCTGTTCCGGGGT
TTCAATTGGGGTAGTATTCAAGCTCGCCACAGTGTTTATGTCTAGGCGTGGTCGTGAGCTTCATCGGGTGATAACGGTAAGTATCGACGGAGGAACTGCG
TGACCTTCGTTGCAGTCTTCAGGAATGGGTCGGGGAAGTAGACCATCGCCATCCCCACAAGCGCTTCGCAAAACTCGCTGTAGATCAACTCAAGCTGGTC
GTCATTTCCAGGCGTGGCTTCTTGGACGTTGCGAAACACGTTCAT