Description :
From Genome Similarity Track
Location :
Scaffold_2218:419- 1642
Transcript NameFunction/comments
Phyta_totarag14258Avh143

Sequence
1223 bases(100 bases per row)
GAGCGAGGGGGACAACGTGTGCTCTGGACCAGCATTTTTGGTTATGTTTAAAACTGATTCGATGGAAGTGATCTATATCGTTTAAAACATTCAGAGACTG
ATAACTTATGCTGGATTCCTCCATTCTAGAAAACTACGCAGAGGTAATCCGTTTTGTACGCGGAGTTAATCCGCAACCCATACTGTAGCTGACAGTCTTT
GGACAAAAATTATCCTGGTAGTGCTACGGCCACGTAGTACGTAGGGATTAATTCAGGGCTGCAAGTATGTGGACCACTCTACTAGTAGGTACTGCTTTGC
ATACAAACATGACGTGACGTGACCTATACTTTCATCATTTCGTATCAAACTCTGCAAGTTTACCAAACTACACAAGTTTTCACACCGAAATGTATAAACT
CTAGCAAGATGGACGCTTAAGTAACATAATCGTTATGGTACTTTGCGAATTTCTGATTTCTTACGTAAACCATGTTAGTATGATAAGCAGCTGAGGTTGC
ATACAGTTTAAGTGAACATGGCTTTGCCATAATGCTCGAGAGGGGCAATATTTATCCAGTGTTGCGGTATTCCATACCGTGCTCGCAAGGCACCTATATA
CTTAGCCGTCCTGAAGGAATGCGGTGATCGAGGATCTACTGGACTCTTCCTCTTCTGTGAAATAGGAGCTGTGTTTCCAGAAATTTAAGAATGAGATGAT
TAAGGGCCGGCTGGATCAACCAAATCATCCGGTCAACAcaagtcgttgaagctggacgaggcagGAGATGACCTTATCACCAGTCCACTGTTGAGCACGT
GGGTCCAGTACATGAAAGCGTTCAACAAGCGGTATCCGTGCACTGAGACGACGGTGATCCAGATATTTACCAAGAGCTACGGCGACGGGAAGCTGGTGAC
GATGACCCAAGCGGTGATGAAGGTCCCGGACACCGAGCAATTCGCGAAGATGCAGACAGCTCAGTTCACACAGTGGATGACTGCCAAGAAGACTCTGGAT
AACATCTACAAGACTGGGTTGACGCCCAGCAGCCCGAACACTAACATTTGGCTTGCGTACCACAATTCGTACGATTGGTCTGAAACATGCTCTCACCCAT
GGCTCGATCGAAATTGCTCTACTTGCCCCATTCGAAAAGGTACGATTGTAGTTTGCTAGACAACATATCAACGAAGTAAAACCCGTGACAACACCGCCCC
TCAATAAAACAAAACGAAGTATA