Description :
From Genome Similarity Track
Location :
contig_26:418992- 420142
Transcript NameFunction/comments
g6483.t1hypothetical protein

Sequence
1150 bases(100 bases per row)
ACACGAGACTCAATAGCTGTACCATGCAATTGCATCTTACCGTTAGTGTTGATATTGGGACGCGGCAGGACTTGCTTGGAACAACAGTAAACAAACCTTG
ACCAACAACAGAGTCGATAATTCTTCCGCACAAGCTACCACCTTGTATGCTGGCCTTGTTCGCACCTACGCTTACGGGGGCGTAGTCTCGACCTCACGGT
TCTGGCACGCCATCATGATTGCCGTTTGCGCCCACTCGACACCAAAACTGCCACATTTCATTGCCAGTCCAGCGCACTGACGAGCTTGAGCAGTAGTCTT
GCAGTAAAGAAGACCGTTGATCACCGGCGTCTTGGTCTCCAAGCTCGTCATCATGATCGCATTTGCCACCGCGTCGGCTACAACTCCACAAGGGAGAGAC
GCTCCTTCCACCATGCAGCCCACGACAATTACAGCGTCCAAAGGCTCTGGAGCGGAACAAATCAGTTGCTTGGTCGTGTAGGGGAGCTCCGTAGGCAAAG
CAACCTGCGCCACGTGGAGGTTGTGGCTCTCAACGCCCTTGAGCATCAGTTCGCTGCAGCACGTCGCTACTAGCGTGTCCACCACGTCAGCATAGCCACG
GGTAGAGATGACGCCGATCTGCAAACTTGACCCATCGAGTTTGGCCGTCGCCTCAACGCCGGGCTCTTCAATCAGCAGGGGCCTCGGAGCACCAGAAACT
TCCTCGCTTGCCGCTTGGCCAGCTTGGTGGTGGCGATGAGGGTTACCACGGCGGTGATGTCGACGACGGCGTGAAGCCTTAGCGCTGGTCGGGTGGTTTG
CTTCCTCCATTCAAGCAACAGCTCAAGCAATTTGCTTTGTGCTGCTGTTTGAGCTGCAGCGTGTACGTGTACTAACAAGAAAAAGACCGTTGGCGGTCAA
GCCAACACTGCTCTTTTCCCACGAACCCATCACAGCGAGAAGACCCGCTTCACACGAGGCAGTTGGCATGAAAAACAATCCTCGTCGCTTCACATTATCA
TTACACGACACCCATCGTACCTCTTCTCATTTGCTGCACACAGTTCTCTATCGAAACGTCCACCTCGTGCTTAGTCCGTGGTAAGGAACTTGACGCCGTC
TTCCTCGCACGTCTCGCCGGCAATCACCGCAGCCTGCAGCAGCAATTCAT