Description :
From Genome Similarity Track
Location :
Scaffold_81:41896- 45753
Transcript NameFunction/comments
Phyca_LT1534129120secreted RxLR effector peptide protein, putative

Sequence
3857 bases(100 bases per row)
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctgctttaagtttatctgcgacacaacgtatgttcg
taatccgtgctacctagatgtatatgtacggatcgtgagctgttgtacggccgtcggccagtgatcgtgactaagttttcatttacagttttacttcact
ggaagccatgcgtcttcgagatattgagtgcttggctattgccgtctttctccttttcgtcagtagctccgcgttatcaactcgaagcggttcaccgcct
aggaaactcctacgtcttggagatgaagagagggccatcacggttctcgacgacatcacggctagttttttaagtcctattacccgccttaaccttcgca
agtggtacaatcaagagaaatccgccgacgaagtcctcgcattgctcaagcttgatgacggagtggatggtcttttatccaggcggaacataaagggatt
gaagaaatacatctcgtggctgaacgccaagaacccggacaatcccgtcactatggtggagacgctatcgaagcagtacaaagacgacctcgtggccaag
atgttggagctggggaagcgctccaagtcgtccagagtgaagaaactggccaacaccctgcaggaagagcagtacctagtgtggaacaacaaggggcaga
acccagaacaggttttccggcttcttcgactcgatgatgccgacacgcttcctctgggcagtaccgtactggatgcctgggttgggtacttaaacaagta
taaagtgtggcatccctcgacgcaaacaaccactttcgaggcgttctggaaagcctacggggacagaagattggcttcgtatctgttcggagcttcgacg
gttccccagacgaaggtcgtcgctgagaatatgcagaaggagctcttcacgttctggttcaacaagaagattaaacccaaccacttgttcacgaaggcgt
tcgggatcaaaccggagcaagtgacgcccacggaagagaagattaaggccctctacgatatgttctactggacacaacggagaatgataaacaacaaata
aagaagaatcagtggtttggagtccaaactttggaccaaacaactgctgttttcttgggattggacgcacagaaaaagagttctccagccatttctcaaa
gtcgaatgcgctgtctcttcctctttctcctcgttgcgacgcttctgctggccaacggggaggccgtcgcgtcgtccaagtaccggtatgaccctcaggt
tgaagaaagagctcttcctgttcgttctccgactgttgcgttcacggattgggtcaagaatttgggtttgaaagtcacaaatacggccaaagcgcgttac
tggctctggaggaagcagtcggtggagaatgttttccacagcctcaagctcgacagtggactggataaaatcctggataatccgaagctccaaacgtggg
ccacttacgtcgacttggtcaataagaggaacccggacagtaaagttaccatggcggaaatcctcattaaaacgtacggggatttaccggtggcggtaat
gctgcaaaggacgagaagttcaccgaaattggctcgaagactgcgcgtggaacagatccaggggtggaaaagtaaaggaaaatctgccgacgaggtcttc
acactcctgaaacttgataaagctggctcggatctcttcgtaagtccacagctaaatacgtggtataactacgtaaacgtgatcgaaaaggacaaggcga
aagctgtgatggcctcggtgttattggctcactacggagaagtaggattatccaaga