Description :
From Genome Similarity Track
Location :
Scaffold_1228:4187- 5722
Transcript NameFunction/comments
Phypl_g12823conserved hypothetical protein

Sequence
1535 bases(100 bases per row)
CCTAGCTGACGTTCAGCTTGGCCTCAACTTCTAGGTGGCCGCCTTGAGACGCGTGAGGCACCCACAAAAGTAGTGAGCCACCTCCTGTACCGGGCAGACC
CAGGAACCCCGGGCGCCACCGATCAAAGTACAGCGTCTTTCCGGCTAAAGCTGTGACATTGGACGTCCACTTGGCAGTGCCGCCAGCTTTGATGTCCACT
TCGTCGATCTTATCGCCACCGGACATGATGTTCACCGTCACGGCCTTGGTGTCTGTGCTCTTGAAATTGACGatgacggcgccgtcgcccttTTTGGTCC
AGGACATCGTGCTCTGGTTGAATGCCTTCTGGATGGTGGTCAAACCAAGCGTCCTGGGATCCGTGCCGTCATCGATCTCACCGATGAAGTTCGTCGGGCC
ACAAACCGTCTGCAGGTACGCAGCGATCAAACCCATCACACCAATAAGATCGAAACCAGtgacggcgatggagatgAGGGTCTTGCTGAAAGCCGTGTAC
ATGAACTGGttggcgtcctcgctcgAGCCGTTGTTGCTCTTGCCCTTTGACACGAGCTGGTTGATCATACCGCTGAAAGCCGTGCGGATCTTTTCGCGGG
TATTGTAGGCCGTGGCTTCGTTGGACTCCGCGATTAGCTGCTccatgcagttgttggtCACGATGGCAATGTCGGACGTCACAAGCGGTGTGTCCTGCAT
CTTCAGGCGCAGATCATCCACCGAGATGCCGGGGTTGTCCGCTCGCAGCTGGTTCACGGTGTTCCACGTGCGGTCGGTCAGTGCTCGCAGGTCGTAGCCG
CAAGTCGAATTGGACTTGAGGGCGTCACTGAGCGTTCCGATCTCCGTCTCGTTGATTTTGCTGGCCGCCTCCGTGAAGTTGGCACCGATCAAAAAAGCCT
TGAACTTACTCCAGCTGGAAGTGATGTCGTCCTTGTAGGCGATGGCGTTCAACAGGATCCAGTTCATCGTCGTAAGCACACGACCAGAGATATCGAGGGG
TCTCGGCAGATCCCACCCCATGCACAGGTAGACGGCAATCGGCAGATCCGTCACGATGTTGTTCGACTGGTACATGATGTTCAGAATCTTGTCCGTCGAG
GCCTGCGGGTCGGCGGTCTTGATGTTACGCACATAACGGATGATCGATCGCATCGTACCGATCATCATGTTAACGCAGTCGAATGCCCGCGTCACGCCCT
TTGCCACCAGCCACAGCTTCTGGGCGGCACCGAACGAAGCAATGGCCAGGGCCGAGTTAGCCACAGCACCAACCTTGTTGAGAGCTTCCATCGCGCAGTC
ATCGTTCTGACGAATGCACTCCAGGCCGCACTCCACAGGGTAGGCGACCGGGCACTCGGCCCAGCACGTGTTGGTGGCTTCGTTGCGGTCGAAGTTGGTC
GGGCACGTCTCCATAATGTGCACTTCACGGTAGCATGCTGCGTCCGGGGCTACAGGGCGGGGCCCCACCCAGTTCCTGTACGTCGACTTGATCTCACTGG
TAGCATCGGTTACCTTGGCTAGCTCAGCGTTCACC