Description :
From Genome Similarity Track
Location :
Scaffold_184:4187- 5487
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19790hypothetical protein

Sequence
1300 bases(100 bases per row)
ACGGCATCCTCGGCGCGCATCCCATGCTCCAGCACTCGATCCCGGATGCTCGCGGACTTATGGTCAAGCACGAAGCCGTCTTCAAGAAACAGCTTCATGA
ACGCGACCAGCAGCTTTGCTTTCGACCGCTGCTGCTTTGGTTCTTCGGTATACCAGCGTGGCTCTTGCGCATACCAGGTAAACCAAGTTGCATGAAGGTG
CGTAACAGATCCTCTGCGCTGTTTCTTCTTGGGCTCGCTCACATCTGGTATGGCTTCATCTTGTCTATCCCTTTTATGCGTTGCAGCTACAGGATCTCAG
TTTATCTTTGCCTCTAGCATGTTCATGCGGCGCTGGGAATTCTCAAAAAGGTGTTTAATGACAGCGGCTTGGTGCTCGATGATCTTCTTTTCTTGGCTTG
GCTCTGTTGAGTTGGATTCGTGCTTGCGTGGTGGTGTGGCGGGTTCTTCACTTTCTTTAGAGGGGTTCCGAGCCCAGCGTGTGCAACACAGGTTTCGAGT
CGATTCACCGCGGGACTTTTAGGATTCAAGTCCTTCAACACACGATAGTGCCGAACGAGGCAGGCGGTAAGAACTTCCAGAACCTTTCGGTTGATGTTGA
AGGCCTCCGTCTCAAGTTAGTAGCAAGCTGCGAACAGTACCCGTTGGAACCGGGCGATCGAGTCAAGCGTGTCGGCCTCTAAGCTGGATAGGTCTTGGAG
ATGGACAGGGGCCGACGGTTTGTATCGGCTCAATACCTTGGTAATCATGTGATCTTCTCTACTCGTGTTGAATATGTAGTTGAATCCCTTGTTTGTGGTG
CTTAGGTTCCAAGATCCGCGGTCAAAGATCCAGCGCGCAGTCATCTTCTCACAGCCGTTGGCATGCGGTGCCCCACCGCGGTGGAAGGGGCGCGACGTTA
GCGCAGCCGACACATCAGCGGGAGGGCAGATGCGATCAAGCACACGGTTAACATGCGCGTAAATAGTCGGTGTCGTGCCAGCACGAGACGGTGGAGGCAC
AGGCATCGAAAGACCAGAGGTCGACGGCGGTGCGTTGAGAAGCTCCACGATCGGAACATCCGGAGAGAGCGAGGTCGGTGTTTGGAGGATTTGGTCGGGC
AGGTTGTCGATGAGAGCTGGGGACGGTGCGGCTTGGGCGGAGAGGGCAAGCGCGACAACGAGCAAGGGATACGTAGAAAAGTCGGTGTCTGGGAAGAGCG
ACAGGCCTTGCTCTTCCGATATCTTGACACGGACCAAGCGTAGGAAAAAGACATCCGCAGCATCAACGGAGATGTTCCGCTTCTTGATCATCGACAGCTC