Description :
From Genome Similarity Track
Location :
Scaffold_717:4185- 6560
Sequence
2375 bases(100 bases per row)
GATACACCCATGCCTGAGGTACAACCTCCTACTACGTTAAGTCCATTCTCTGAACGTGATGATGCGAATGCGCCATTGGCGCCGCATTGAATACCCGGTT
CGGATGATGCAATCATCACCAACCTGCTCGATGAGCAGCAACAGTTGGCTATTCAACGAGAAGAAAGCGCTCGGCGCCATGCGCTAATGGTCACGACCCT
TAAGAACCAGCGTGACTATGTGTTCACTCCACTCAGTGTAGAGAAACGTCTACGTCAAACGACTGGCCAAACGTTGGCAACGTAGACCATTGGTCCTGGA
GCTACTACTCTCGAGGAAGGGGAAAGTGGCCAGGCACTTCGTGAGAGGTACCTGGAGCCATATCTAACAACGAAAAGTCAGTACAAGGCACGCCTTGAGA
TGCAAGCACGTGGTGCACCGGTTCCACCGACTAAGAGTGTACCCATTCTCGTGTTCGCAGGCGAAACAACGGACGAAGAAGACGACGCCTTCGTTCTCTG
GGTGCACCGCACTCGTCGCCTCAGCAGTATGTATGCTCTGAGAGCTAGTGTCAGTGTGGCCGATGTGCGTCTCGAACGCAAGCTTCGGTATGATTATGCC
AAGCTTAAGGCCAATTGCGCAATCGCACGCGCTATGCTTTGGCTACTGGTAGTCGCGAGTTCTGGTTAGATCGTGACCAACAACCCGCCAACCGACACCA
CTAGTGGTGGGAAACGGCCTCGGTCTCGAGATGACACTGGCCACGATGTTCAAAAACATCCACGGTGTAGGGGCAATCTTGCTGAAGGGGTGTCTCGTAC
TCCGATGAGTTCTCCGACTCCCGGTACCCACGCCACTTCACCAGATATTGGTATTGGCCATGACGACGACGTCGTTTCAGGAGTCTCTCCACATGGAGCT
GGCGGTTCCCTTGCTCATCGAGCAGCATCGGTGGAGGTCGGTGGACCGAAGGAAGATCATGAGATGATACTTTTCGAGCTGAGTGGTCTCCGTGAGACAT
TGGGTAAGACCCAGAGTGAGCTCGACGCGACGCAAGCTCGCGTTCAGGCGTTGGAGTCGGGTCACCCCCCCGGATGGAGGCCCAGCCTGACCTCCTGGTT
TGGATTCAGCAAGCGATGGCAAGGTCAACCTCCGCGGTGCAAGCGCCTCCAAGTTCACGTGGGACGGATCCCGATACGGCTTAAGCAATCCAACGTAGAA
CACAGGATGTGTGCGCAATTTGCGTGGAAGGTTTAGCGTATACGCAGTTCCCTTCTTATCAGTGACCGTAAATGGTCCAATGAAGCGTGGACACAACTTT
GTCTTGAAGACAGCGGACACAACATTTGTAGGTATATTTTTAGCATTGAGTAATACTTGGTCTCCGACCTGATAACGTTCAATACAACCTCTGTTTTTAT
ACAACCTCTGTTTTTTGCTTGTTGTTTTTGTTGGTCTTGGCTTTCAGCCATTGCGTCACGCATATGTATTAAGACATTCAATCGCGTTGCGGTGCGAATC
TCATTAATGACGCGATTAACACACTCAGTTTGACCATCGGTCTGCGGATGATTCGCTGTGGACATGTCCGAACGGGTGCCGAGCACCTTGAAGATGGACT
TCCAAAACTTCCCAGTGAAGCGGGGATCTCTATTAGAGAAAAGCTAGCCATGTTGTCAAAACACACGGTTGATAAACAGCTTTGCTGTACCTTCTGCATC
AATAGAGTCCGGCACTGCCGCTAGATGAGCCACTTGCTCAATCGGTCAACAAAGACCACAATGCCAGTGTTGCCTTCCGAATCTTTCGGTAGGCCAAACA
CAAAGCCCATGCTGATGGACTCCCAACACCCAGAGTGTACAGGCAGACTAGCCAGCGGCGCCGCCGCATGTGCTGAGGGTTTCACCCGTTAACACGTTTC
ACACGTACGCACATAGGTGCTCACCCACTTGTATAGTTTGGGCCACCAATAAGCCTGGCTCACTGAGCTATAGGTCTTCTCACGACCGAGATGACCACTT
TAAGCGGTTTCATGTGCCTCATAGAAGATTCGATACTTCAACTCCTCATCATGAGGGACAGCAATACGAGGGTTATCCTCAATATCTGTGCGATAGCACA
ACAGGCCATTATCGATAGAATATCGATGTAGCCTCGCACGCAAACGTGCCGACAATTCGATGTCCGAGTCTTTAAACGACTCGCTCCCAAGAGCACGTAG
CAAAGCTACACATTGTGTCATCCTTGACATAAGCCGCACGGATTAAGTCAGTGACCGACGATGACAGCGTAGTGACGTGAGCAAGCTCATAGTCAGTCGG
CGCGATAGCGCATCGGCCAAAGCATTTTGCTTTCCTGGCTTATACTTCCACTTCGAAGTTAATATTCTGCAAAGA