Description :
From Genome Similarity Track
Location :
contig_26:418404- 419553
Transcript NameFunction/comments
g5492.t1conserved hypothetical protein

Sequence
1149 bases(100 bases per row)
ACGAACGCTTCTCCGCGCAAGTATCAGCCTGCGACTCGCTATCGCAGCATAGAACGCCGAAAATCACAGGCGTCTCCGACTTCACGTTCAGCTCCATGAT
CCCGTGCGCAACCGCGTGGCTCATCGTCTCGCACATGTGCGTGGCGTCGTTCACAATGCAGCCGATGCAGATCACGGCGTCCGGGCGGTGGCTTACGTCC
TTGCAGTGGACCAAGCGCGCAGCCGCAAACGGTATCTCGAATGCTCCGGCCACTTCCACAAGGTGCAGATCGTCGTCCGCAACGCCCTTGGCCAGCAGCT
CGTCCGAGCACTCTTTCACCAGCGAGTGGACAACCTTCTCGTACCAGCGGGACGCGATGATGGCAACGCGCAGCCCGGTGCCATCGAGCTTGCCGGATTG
GGCGACACCAGGCTGCTCGATCAGCACTGGACCATGCGGGGACTCAGCCTTGCCTTCTTCCTGGCTGTGGGAGCACCTTCCGACTTTTCCGTGTGTTTCA
TCTTCGTCGTCGTCTTCACACCCATCGTTTTCAGGAATGAGCTGACACTCCGAGCGCGAACAAGGAAAATGGGAAGCGCCTTGGATAGCTTCAACACGGT
CTCGCTGGGACGTGGTGTGATTGACTTCAACTGCCCCAAGATACCTGTCGCTGCTCACAGGAACACGAGACTCAATAGCTGTACCATGCAATTGCATCTT
ACCGTTAGTGTTGATATTGGGACGCGGCAGGACTTGCTTGGAACAACAGTAAACAAACCTTGACCAACAACAGAGTCGATAATTCTTCCGCACAAGCTAC
CACCTTGTATGCTGGCCTTGTTCGCACCTACGCTTACGGGGGCGTAGTCTCGACCTCACGGTTCTGGCACGCCATCATGATTGCCGTTTGCGCCCACTCG
ACACCAAAACTGCCACATTTCATTGCCAGTCCAGCGCACTGACGAGCTTGAGAGTAGTCTTGCAGTAAAGAAGACCGTTGATCACCGGCGTCTTGGTCTC
CAAGCTCGTCATCAGATCGCATTTGCCACCGCGTCGGCTACAACTCCACAAGGGAGAGACGCTCCTTCCACCATGCAGCCCACGACAATTACAGCGTCCA
AAGGCTCTGGAGCGGAACAAATCAGTTGCTTGGTCGTGTAGGGGAGCTC