Description :
From Genome Similarity Track
Location :
Scaffold_1193:4184- 5755
Sequence
1571 bases(100 bases per row)
CGCCATCGCGGGTAGACTACCTGAACCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAG
ATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGG
GCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGG
GAAGAAAGGCGAGAACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTC
TCCAACCTTAGCGGTCGTGCTAAGATTTGGGTGTACACTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAG
CCGCGTTCCTCCCGGCGAGCTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAAGAAGGGGCGAACGGCACGAGTATGTGCAAGAGATACG
GGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTG
TTCCGGGTGTAGGCAAGCACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTG
GGAGCTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCTGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGG
GAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTCCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCC
CGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGA
CTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGGTACGATCACCCCTTTAGA
ATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGCGAGAAAGCAAGGGCA
ACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGA
ACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATC
GGTGCCAGCCGCCCTGCGCAGTCCGACAGAAACATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGG