Description :
From Genome Similarity Track
Location :
Scaffold_762:4183- 5818
Sequence
1635 bases(100 bases per row)
AAACACACGATCGATAAACAGCATAGCTGTACCTTTGCCATCGATGGAATCCGGCACTTCCGCTAAGTGAGCCATCTTGCTTAAACGGTCAGCAAAGACC
ACAATACCCGTAGTACCGTCACTGTCTTTAGGAATAACAAACACAAAATCTATACTGATGGACTCCCAACACCACGTGGGCACAGGTGAACTGGCGAGTG
GCGCAGCCGAATGTACTGAGGGTTTGACCAGCTGGCACGTTTCGTATGTACGCACGTATGTGCCCACCCATTCGTAGAGCTTGGGCCACCAGTAGTGTTG
ACTCACAGAGCCATAAGTATTTTCCCGGCCCAAATGCCCACTGAGGGCAGTATTATGCGCCTAAAAGAGGATTCGATATTTTAAGTCCTCATTGTGAGGC
ACAACAATGCGGGCGGTATCCGCTACATCTGTGTGATAGTACACGTGGCCATTATCGATGGAATATCGATGTAGGCTGACCCGCAAGCGTGCCGATAATT
GAATGTCCAAGTCCTTGTACTCCTCACCCCCAAGGGCATGAAACAATGCTACACATTGAGAATCCCGTGGATGTGCCACCCACAAATTAACTCCTCAATA
GGGGACGACAAAGTCGTGACATGAGCAAGCTCATAATCAGGTCTGCGAAAGAGGGCATCTGCCAACACATGTTGTTTTCCTGGCCTATACTTCACCTCAA
AGTTATATTCCGCAAAGAAGGAAAGCCACCGAGCCATTCTCTGAGAGAGGTGAGGCGACTGTGTCGCCGTGCGTAATGACGCACGATCCGTATAGAAGAA
GAATGGCTTGGATCCAAGCAGATGGACCCTAAAATTTGACGAGCGCATACTTCATAGCAAATAGCTCTTTGTCATGAACTGGATAGTTCTTTTCAGCAGC
TTTCAGCTGACGAGAATTAAATGCGATAACTCGCTCGCGGCCTGCAGCATCTGTTCGTAACAGGGCGCTGCCTATGGAGAAGTCGGATGCGTCGCAGACG
ACACTAAATTGTTACTCAGGATTTGGCAACGCCAAAATGGGAGCATGGAGGATACTTTCCTTTATTGCCCGAACTGCGTCAGCATGGGTGTTGTCCCAAC
GCCAATATGTGTCCTTCTTAACGAGATTAGTTAATGGCCGAGCCATATCAGCGTAATTTTCACTGTATTTGTGTAAGTAATTGGCAAGGCCAACCCACTT
ACGCAAGTCTTTTTGATTCTTAGGAATCGGCCAGTCAACTATAGCCTTGACCTTAGCGAGATTCGCTCTAAGGCCGCGCTTACCAATGAAACAGCCGAGA
AAAGGAATCTCCTCTGCACCAAAAATGCATTTAGACGCGTTGGCGTACAATTTATTAGTGCGCATGCACTCGAGCACGGCTAGCAAATGATTGATCTGGT
TGTCAACATCTGACTGACCTTGTTCGGCATGACTATGGACAAAAATGTCATCAAAGTACGTTTGTGCGTAATCCCGATGTGGGCGGAAAAGTTGCGTCAC
CAGACGATTAAATGTTGCCAGAGCATTAGACAGCCCTTGGAGCATCACCAGACATCCCCATAGCATACCACTCGGAGTTCTCACTGCTGTAGGTGGAATT
TCACTCGCTCGCATAAGCAATTGATAATATCCATC