Description :
From Genome Similarity Track
Location :
Scaffold_341:41826- 44586
Sequence
2760 bases(100 bases per row)
CCTCGGATGAAGAGGAGGAGAAGGAGGAAGAAGAGGAAGAGGAGGAGGATGCTATCGTTGAGCCCCGGGAGGTCTCGAATGACCTCGACCAGCAGCAGGA
GGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCGGTGGCGGCACCCATCAGCCAGGGAGCTGCCATCAATTCAAGAGGGTATTGGCCTCCCGAGGAG
AGCTCTGGGGCTGACCTCTTCTTGGAGGTTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCCACACTTCTAGGGGAATCTATGAACGAGCCCTTGTTCAGA
AAGAACAGTTGTTCGTCGACAACTTGGAGGCTGCTCGGTGTGTGCTTCTCGCGCCACACCGCATTCCCCTTAAGGACTTCACGACTTGTCGTAAGAAGCC
CGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGATACCCCTGGGTTATGCTCGAGAACTGTCCCACGTGGAGTTCTTGTGAGGACATGTTCTGGGCGTGG
GTGGAGACTCTCAAGTACTCGCCCACGGAGTTATGGGAACTCCATGAAGATCAGCAGCTGTCCCACATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTG
CCCACTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCGCGCGGCTTCTAGCGCTCACGATGAGCGCGGGTACGGTATGTATTCATCGTCCGT
ACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCACCGCTTCTGTTCCCAGATTGCGACAGTCTTTGTGGTGTAGCGGGATCAGCAAAATC
TGCGAGATTGCCGGATCCAGCTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGT
GTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGCTCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGGGGTGGAG
CAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGT
AGGGTTGCCTTGCGGGTGTGTCCCTTGCCTTTGCGTTCCTTTGCGCTGTACTTGCCGCCGCCTGTGACGGGATCTTGAGAGTTGAGAGCCCTTAGGGTGT
AACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATC
ACTACCAACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGTCACTGTG
CAAATTGGAGTCTGTATTGATATTTAAGCCTATACCTGCCTGGATTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCATGT
CCCTTCTTCCCTTGACCCATCATCCCAGCTGTATTATCTTCAGATCCACCGGATCCATGACGTAATCATCATGGTCACCCTATTATGGGTACACTCATCC
GGATCCAGGTCGCTTGGATCCACTTCACTGTAAGTTTGCACTCGTCGTCGATCTGAGCTCTCCCATCATCCAACATCATCTCGCAACCGTCTGTGATCTC
CATTGTCCCACGAAAGTTCGAGATCCACTGTATCCATCATCCCTATACCCTGGATCCAGGTCCCTCCAGGCGGGATCCTCCCTCCTTGGATCCGAACTCG
GAAGTATGGGATCCGGGGTACCTCGCGGTGGATCTTGACTCTTCATTAGCCGTGACTACTAGAGCCACCTTCAGAGGGCACCGACCATCCTTCCTTCATA
GGATCCACACTCGATCCACTCTTGTATAGTATATCCCATATCCATCTTAGTGAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTGCCTT
CTCGTACGTCGCTCATATCAGATCCATCGTCATTCCATACGGGGTGCTGCTCGCCATGGCTAATCCACCACAGGCAACTTGCATCCGTGCCAGCCAACCC
AAATCCTCTCTAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGCCCATTCTCTTATTTCTGAAAAAGCACTTCACCACAATCGCC
TCTGTGGTGTTGGAAATCCCACGTGAACTCTAGCTACAGATGTAGTTAGGATGTTCCCACAACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCG
GACCTGAAGACCCCAGTTCTGCCCTTGCACCGGGACAAACTGGACCTTGTAAACTACTTATATAGGCCAACCAGTAAAATAAGAACACGCTACTAGCACG
AGCAAAGCTAGCAGGTGTTTTGAATCCTCGTGGTCCCAACAGCGGAAGGGTACCAGGCACGGGTAAGCCTTTTACGAGATCACCGAGTGTTCAACACTCG
GCTGGAAGAAATAAAAGGGAGGCAATTCAAGCACTCCCAGTCGTGCAAATAGGCAACAATAAGCCGTCACGTAAAACCTCCCGATAATAATCGGCCAATA
CACAAAGTCTCTTGGCCTTGCCGGATGAACCCTCGCTACAGAGCTTCGAGTTCACCGACAGGCATAACACACTCAAACAAGCTTGACCTGACGCTTACCT
TGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTGTTCTGTATTTAAGCTTACC