Description :
From Genome Similarity Track
Location :
Scaffold_56:41824- 43008
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16169hypothetical protein
Phypa_INRA-310PPTG_16170hypothetical protein

Sequence
1184 bases(100 bases per row)
AAGTAAGGGATCTCGCCTTGTGTGGTCACTCGAACGGCGTGTCGGTTGCCAGGTAAGTAGTCGAACGTGGCGAAGTGAGCGGTGATGCGGTTGTCCCAGA
CCGCCACAGCATTCTTGGACCAGCGGAAGCGAACTTGGAACTCGTGGCCCTCCGTGATATGCTTATACAGCACTTTGAGCACTGCATCTGTATGACCACA
AAAAAACGTTAATCACGAATATTTCATTCACAGCACACCAACGTCCAAGCTTATCGTACCTGACTCGCGAGAAGAGAGCTGCCGAATGCGTCTAGTGAAC
GCGGGGTTGACAAACAGAGCCTTGCGTCCAGTGACCGGGTGGGTGCGCACGACCGGGTGCTCAAATTCCACCGGAGCTCGACGAATTGTATGTCCACGTT
GCTCTGCTCGCTCGGCTTGAGCCTTGCTGCTGTGAATCGCTGTCAACCCCTCAATGAACTTCTTGAATGGCGGTGAGAGTCGCTCGTAAGCTTCGTATGC
GGATGCCCACAAGGTGTCACCACCAAGCGGAGGGTTCGTTAACACCTTGAAGCTCGTGTACGACGGAGGCTGACGCTCGTTAGACACGTCACTGTGCCAC
ACATTATCCGGGTCGTACTGCTGGCGTTTGATGATACGGTCGCTGTCAGCCACCGAGTTCTCGACCACCAGCACTTCCGGGTGTCCTTCAGGGTGACCGA
GGTTCTGGTGTACGTGTAGAGGTCCGTAGTAGCGACCGAGATCAATCTGCTGCTCGATATTAATCTCCTGGTCTCGAAAGAAGACTACGCCGCGGTGAGA
GACCAGCAGGGCAAGCTCATCGCGCTGCGCGTCCGTGAGCTCATGCAGTTGAATACCCGACAGTTCCGTGCCGATTTTCGGCGCCAAGTGCGTCACTGTG
GCATCCTTGAGTAGGTTCTTGAACGTCGGGTCGGCCTTCAGTCCTCGGTCCTCGTACGGTAGCACCGGAATGGGGTCGTATTTGGTCGTGGGGTACACAC
TGCGCAGTTCAGGGTGCTCAAACTCGAAATGCTCCACCTCTTCGTTGAGCGCGTTCTTGATGGGCTTTGGCTTGGTTGCGGGCACCGTTTTCTCCACGGA
AGGCGCGGTGGTGGTCGTAGCCACAGTCTGAGAGTCTTGTTGTTGAGGAGCCATTGTTGTTGTCACGGGGTGAATTGGAAAGTG