Description :
From Genome Similarity Track
Location :
Scaffold_127:41810- 43297
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_127-snap-gene-0.42B-box zinc finger family protein

Sequence
1487 bases(100 bases per row)
CCCACGAGTTGAAGATCTGCTTTCACATGTTCTCCGCCCATTGAAGTTGACGACGGTGGGAAGTTGCGTTGTTCTGCCCGTAGGAGCTTATGTTGATTCC
ACGTCGCCAAGAACTCGACCACTGAGGAGGCAGCTCGCTGGTCATTTAGGCAGCTGTCAAGCCACTCGATCTGCTGCAGTTGTCGTTTGAGCTCGAGGGC
CTCGCCGTCCAGCACATTCATCTTCTTTTGTGCTTCCGTCTCCAGCTGTTCAAGGGCGCTTTCATACTGTGCTCTGAGGGCAGCGGCGACTCTCTCTCGA
TTATTCACTACTTCATCCTTCGCCACTGAGATCACGTTGAGCTTGCTTTCGATTACTGACTTGCGAGCGTCAATCAGTGGATCGCTTTTGAAAGATTCGC
GTAGACTGCGTTCGTAGGCATCAGCAATGCTCAGCAGTCGATGTGATCCCTTATCTCCAATCGAGTGATCACCAATCATCTTACAATTGACGCATACAGG
GGCCGCACAAATCGGGCAGTAGAACTCAGCTTTTTTCtCGTCGTGCACTACACACGTGCCTTGATAATCGACCATGGTCTCCTCAACATGCTTTGCCACG
AGTGCGTCGAGTTGGACTTCGCTTTCATCGCCTACTGACGCTGACTGGTTCGAATCATGCCCTCCATCACTTGCAGGCATCGAGTTGCGGCGATGGGCTC
TACTAGCCACCACACTAAGAGAGCGATCGCGTTTCATGGATCGTTTGTGTCGCTCCGCGAGCTTGTTGGCAGAGTGCACTTCCTGGTCGCACTGCGAACA
CAATTCCGCATCGCACGCTTTGCAGATCAAAACAGCCGATCGCTTTTCACATAGTGCACACGCTTGTGTGTTCTTAGCATCGTTCTCACTGTAGGAGAAC
CGCACGAGATACTGGGGTAAGATCTGGAGTGCGTCAGTCAAGATATACCCATGTTGGTACACTCCAGGCAGTGCTGTGTtAGTTGGAGACTGATTGATGT
AGTAGCTGTGGTAgCCTGGTGGAAGCGGATGAGTCCTCGCTtCGTCGTCGCTGGTGATGACGAACGACCGGCCGACTGCAATCTTGCACAAAaCGAGCTG
CTTGCGACCTCGCTTGCACTTGCCCGCTCCGAAAGAAATGGTCCCCGTTGTGAACTTCATAGCCGTATGCTCATCGGCAACTTGTGTGAAACCGTAGTTG
TGGACATCGCCCATCGCGGCACTGAGACTGTCAACTTCGACCCATGTCTCCAGCTCGAGGAGTCCGTTCGTGCGTGCTTCGTACTGCGCGTTCAGGTCAG
GATTACGCATATCCCACATTTGGATATCATCATGGACTCGACACGCCAAGAGCGAACACTGCAGCAGGTACTTCACTCGACAAAATTCTTTCGCTGTCGT
GCTCAACGGGCTAATGCTGGCGACAGCTCCCACTGCAGGAACCGTCCGGTATTTGCTTCCAGCAGAATCTTCGTCGTTGGCGGCTGA