Description :
From Genome Similarity Track
Location :
Scaffold_267:4181- 8223
Sequence
4042 bases(100 bases per row)
CATGGCACGGGGAAATGCCGATACCCAGTAGGCACGGGGCGCCCTACTGGGGAAGAACTAGGTTCTGTAACACCTTGAGGAGGTAAAGTTGAACAGGGCT
TGGCCAAAGAGTTCCATACCTACTGGTATGGAGCGTGGATACAAGGCTGGCTTGTTAGTCGCTGAGGCAAAAGTTAAAGGCTTTGAAAAGCCATGGTCGA
TTTTAATCGATTTTGGAGCGTCTTGCAATTATGCTCGACGTCGTTCCCTTGAGAGAATTCAGCTGTATGCTGAAGTGCTGACAGCGCATGAAGGTGATTC
CATCACGGTTCGTTTAGCGACTGGAAGTCGTGTCACTTTACCTAAAGTCCCTTTGAACTTAGATATAAAGTTTTGGACTTTGATAGCATTGAACGCTGTC
TTGTCCTTGATTTGGACTCGAGGTATGATCTCATCCTAGGTATGGCTTGGCTTGAACGCCATGAGCATGGATTGATCGGAGGTCGAAGACCTTTGGCGCT
ACGCGCAATGTTCCTAGCGAAGTTTTGGAGAGTCATGAACCCACCTTTGCTAGGCAACAAAAGCACTATTGGCGCGACCCTTTGACAGAAGATGTCAATG
TGCTGGACATTGGAATATCTGGGTTAACTAACTCCAATGTTGAAAACATGAATTCCGAGCGGAGCTCGTTGAGTATTGGTGATACGGCACGTACTCCGTT
AAGTGTCACTCGTTGTGATAACGAGTCACTGCATGCTGAAAGCATGGTTGGCCTAGGGCCGAGTTATCAAGGGTGTGATTCCTCTGATGTGTGTGGGGTG
GCACGTGAAAATGCACCGAGTGCGGTCGGCCGTGAAGGCACCACACTTAATGTCGGTAATGACATCAGCTCTCGTATAGAGCGTACTACTACTACTAGTA
ACCACGGGGACACTATTGTCCCGACCCCAGAGGGGTGTAAGGTCTGATCGAAGAGACGACCGGGACGCCAGTGGAAACTGTTAAGCGTCAGGCGTCCGTG
CAGTCACATAGTGACAATAGTGATACACTATATACATTTGTCAACGGAGTGACTGGCCAGGTTGAGGGCAATGTTAGCCTGGAAACCCTTCCATCTTTGG
ATGCTCTTTGTGAGCTAGACGAAATGTCTGATGGCGTGTTTAGACAGGCCTTGAAGGCAGGATATTTATCCGAATTAGTGGTCATTAGACCCGATGTCGA
GTTGAACTTGTCCTCATTAATGTATGAGTCGGTCTTAGAGGATACCAAGGCGGCACTCAGTGCCCGGAGTGGATCTTCGATCCTTAATGGTCCCTTGGAT
CCATTCTATCCTTTGGTAAAGGAATTTCAGGATGTGGTGTGTCACAACCCACCATCTTTCTTACCTCCCGATAGAGGTTTACGTCACGAAATTGACCTAG
TTTCAGGAACTAAATACTGCGTAACATGGGAGTGGTCTTTACCTAAGGAACTGTGTGACGTCATTGACGATTTCTTTCGTGCTAAGCACACGGCGGTAAT
GGTGAGGGAGAGTAAGTCTCCCCATTCCACACCTACTTTTTGTGTCAAAAAGCCTCATGGTAAGTGGCGTATTGTGCACGTTTATATTAATCTCAATGCT
GCCACTATCCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTGGGATGTACATTGTACAGTGCGCTAGACTTAGTCGATGGTT
ATTACCAGCTGCTCATGCGAGCAAGCGATATTCCTCTAACAGCGGTTAGTACCCCGAGCGGTATGCTCTGGGGGTGGCTCGTTATGCCACAAGGGCTGTC
AAATGCCCCGGCTACTTTTAACCGTCTGGTGACGCAACTATTCAGACCTCATAGAGGCTATGAACAAACGTACTTTGATGACATCTTTGTCCATAGTCGT
GCAACGAACGGTCGATCTCATGTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATGCGCACGAAAAAATTGTATGCAAATGCATCTTAGT
GCATCTTTGGTGCAGAAGAGATTCCTTTTCTGGGGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGCTAAGATAAGGGCCATAGTTGATTGGCC
GGTTCCGAAGAACCAAAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTTCATAAGTATAGTGCGAAGTACGCAGATATGGCTCAGCCATTATCC
AATCTTCTTAAGAAGGATGTGGATTGGTGTTGGGGTAACACCGAACATGATGCTTTTCAAGCAGTTAAGGAAAGCCTCTTTCTTGCGCCAATACTGGCTT
TGCCCGATCCTGATCGGCCTTTCAGTGTCGCCTGTGACGCATCTGACTTTGCAATAGGCAGTGCTCTGTTACAAACAGATGTCGATGGACGCGAACGCGT
CATTGAATTCGAATCTCGACAGCTCAAAGCTACTGAAAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCTATGCAGTACGCTATATTCAGAGTACAT
CTGCTTGGCTCAAAGCCATTTGTGATCTATACAGATTATTCACCATTGCGCACTGCGACACAGTTGCCGCATCTCTCCCAAAGAATGGCTCGTTGGCTTT
CATTCTTTGCCGAATATAACTTTGAAGTGAAGTATAAGCCAGGAAAGCAAAATGATTTGGCTGATGCGCTATCGCGCCGACCTAACTATGAGATTGCTCA
CGTCACTACGCTGTCATCGTCAGTCACTAACTCAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACATGCTCTTAAAAGCGAGGAG
TTTAAAGACTCGTACATAGAATTGTCGGTAAGTGCGAATCTCCATCGATATTCTATCGATAATGGCCTGTTGTGCTATCGCACAGATATTGAAGATAACC
CTCTTATCGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATCCTCTATGAGGCACATGGTACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTA
TAGCTCAGTGAGCCAGGATTATTGGTGGCCCAAACTATACAGGTGGGTGAGCACCTATGTCCGTACGTGTGAAACGTGTCAACGGATTAAACTCTCAGCA
CATGCGGCGGCGCCGCTGGATAGTCTGCCTGTACCCACTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGGAAGGCA
ACACTAGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCTAGCGGCAGTGCCGGACTCTATTGATGCCGAAGGCACAGCGAAGCTGTTTAT
CGACCGTGTGTTTCGATAACCTTGTTTGCCAATGGCAATTGTCTCTGATAGAGATCCCCGCTTCGCTCGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTC
GGCACCCGTTTGGACATGTCCACAGTGGATCATCCGCAGACGGATGGTCAAACTAAGCGTGCTAATCGCGTCATTAATGACATTGTGGGCAGTGTTTGCG
CTGATACGCCTATGCGTTGGAGCTCCATGCTCCCTGTTGTTGAGTTTGTGTTGAACAACGCTGTTCATGCCTCTACAGGTTATACTCCGTTCTACGTAAA
CGGTCTCACCCACCCTCGCGTTCCGTTAACGCTACCGCTATGTGGTTCAGGGCTTGGTGGGGGAGAGGTTGCCGATAGGCTTGCTGATATCAGCCCTGCT
ACTGTTCAAAAACAGGTAGGCGAGTTTCTTGCAACGCGATTGAATGTCTTACGACATGTGCTTGACGCAATGGCTGAAAGCCAAGACCATCAAAAACAAC
AAGCAGATGCTAAAAACAGAGGTTGTATTGAACGTTATCAAGTCAGAGACCAAGTATTACTCAAATAAAAACCTACGTACAAACGTAGTGTCCGCTGTCT
CCAAGACAAAGTTGCGTCCGCGCTCCATTGGACCATTGACGGTCGTTGCAAAGAAGGGACTTGCGTATACGCTCAACCTTCCACGCAAATTGCGCACACA
TCCTTTGTTCTACGCTGGCTTAATGAAGCCATATCGGGATCC