Description :
From Genome Similarity Track
Location :
Scaffold_150:4181- 5921
Sequence
1740 bases(100 bases per row)
TAACAGACTCTACGAGTCTAGAAGTCCTCTGACTGAGGAGTTAGGGTAGCTCCGCTACTTGGTAGCGCTTGTAGTCAATCTACACCTGAGTCTGCTAAAG
ACTGTTCCTCTGTAAGGATGGAAACAAAGATAAACCTCTCTGAGGCCCAAGGATTAGCGCTAGAGAAACCCAGAGCGCTAGTCGGGAACGAACGAGTGGA
TTTAATCCTCGCACAAGGTCCTGACGTGATCCGTGCACGTCTTGGCGCTTTTATGCAGTTTGAGCCCACTTTGATTGGACAAGTACACGACCATTTGGCA
TCGGTTATGACTACTCAGTTTGTTCATGTACCTGATAAAGAGCCAAGGGCTCGCCCCCTTGTCTTGACTTTAAAGACAGTTGAGGGAACAGAAGGGGAGA
ATCTACTCCTGTGGATCAGGGAGGGGGAAATGGCCATGAACTCCGCTATGCTCTAGTCGGAGCAACAGCGAGTTGGGATGGCTATCCCAAAACTGGGTAG
TAGAGCCAGAGAATGGGCTCTCACGTGTAGTACGTCGGTAGACGAAGCTTTCCCCACATGGGATTTGCGAAAACAGCAAATGTCCCAGGAGTTTGCTCTG
CCTAATCAGGCATACCGGGTGCGTTCTCGTTTCCTATCTGCCTGTCAGGTCAAGAAAGAAATATCGGACTATGTTCAGGAACTGATAACTCTCATCGCTG
CCATGCAGCTTGATCCTTACCAGAAATGGTTCTGGTTATCATCTTCATAGAGAGCCTTCGTACGGGCGTGGCTCGAACGGAAGTATTCCGGGTACACCCC
ACCTCCTTTGAGTCGGCTGTGGATATCGCGTTGAACGCTGAGTTCAACTTTAAAGCAGCCCGTTTTGGCACACATGGGTACAAACCAAACTCGGCGAACT
CCTTTAGTTCTATTAATAGTCTGGAGCCTATGGACCTCAGTCTCGCCGAGACGGACGAAGAATCATATCGTCAAGCTGTAGAACACCATCGAATCATTCG
ACGATGTTTCACGTGCGGAAGCACAAAGCATCTGCGACCTAATTGACCTTTACGCAGGGCACGTCAGAATACTTCAGACCGAACCCCCGCCGCTAACCAG
AAGTCTGGTACGGTGCGAGAAAACGTAGACTCCTAAAAGGCGCGGGGAGCCCTTCGGGGGAAGAACTAGATTCTATTAACCCTATAGGAATTAGTGGCGA
GCAGAATTTAATCCCAAGGAGTGCCGTGCACTTTAATGCAGGACGTGAATACAAGCAAGGCTTATTGTTCGCAAAGGCGACTGCTAAGGGCTTTGAAAAC
CCTGGTCCGTTTTGATCGAATCCGGAGCATCCGTTAATTATGTCAGACGCTTTTCCCTTGAAGGGAGTCCACGTTATGTTGAGGCGCTAAAAGCGCACAA
GGGTTATACGATCACTGTTAGCTTGGCGACAGGAACTATTTTCACTGCACCCAAAGTTCCCGTGAACTTGGGTGTGAACTTTTTCGATTTTGATAGTATC
GAACGCTGTTTAGGCCTTGATTTGGTCTTGAGATATGATCTCATTCTTGATATGGCTTTGCTTAAGCGCCATGAGCCATGGGTCGACTGGAGGTCGAAAA
CATTAGGCGCCACGCGCACTGCCCCTAGCCGAGCTTTGGAGAGTCACGAACTCACCTCTGCTAGGAATCAGAAGCGTTATCGGCGCGAGCCACTGGCTGG
CAATGTTAGTGTGCTGGACATCTGAATGTCAGGGTTAGTT