Description :
From Genome Similarity Track
Location :
Scaffold_274:418- 2133
Transcript NameFunction/comments
Phyke_g7599hypothetical protein PHYSODRAFT_478939

Sequence
1715 bases(100 bases per row)
AATTTGTGGGACGCACGGCCGTCCAAGTACTCGCAGAATATCATCAAGAAagtctgcgtcttcatcttcgttctAACGATTTGTGAGGAGATCGCTAGCT
ATGCTGTCAACCAGTCCCTGAAGAATTTTTTTCAGCGGCTTGGCTGGTCCAACAAGGGTTCCAATTCCATGAAGCTTACTTACGACTCGTTGAGTCAGTT
TGCGTGCATACTGGCGGGCTACCTTTCGGATGAGTTCTTCGgcaagttcaagatgctTCTCATAGCTGCATCCTCGAGCTCCGTGGGATTCGTGCTCATT
GCACTTGCAGCCTTACCTTCTATCCGTGCTACACAGTCATTGAGCAAGGCGCTCTTCTGCATTGGCCTCTTTGGTGGTGTGGCACTCAACCAAGTGTGTC
TTCGAGCTCTCACGGTCTCTTTTGGCGGCGACCAGTTCTCGACTACCTCTCCGCCGAATGAACGTGCAGGCTTCTTCAGTCTGAACTTCTGGGCATCCCG
AATTGGCATCTCACTCAGCTATGCTGTATTTCCGTCGGTAGCCATTCACGGCTTTGGCGCCATCCCGGCCGATTATGGTTTCGTGGCCGTATATCTTGTT
GGCCTGCTTGTGTTACTGATTTTCTTGGGGGTAATGCTGTTCACACGTAAGCGCTATGTTGACGTGCCTCCCACGAGAAGTGCCTTGGGAAGCGTGATCC
GTGTCGTTCTTCAGCGTGCAAAACATAACTTCCGCGCAAGGATGATTGTACTGGCCACTGTTTCATACCTGTCTGCCTTTTTGTTGAATTTTCCAGCGGC
ATTTTTGGGGGACCATGGTGAAATTGGACATAACATTTCGTACGTGTGCGGCGTATTGACGATTTTTGGGACCATCCTGTACATCTACTTCGCGCGAGAT
TCTTCCTTTATTGACGGTGCGACGGATGCTCAGGGGATCGAGCTCGATCGTGAGACGATTAACGGCATCAAGCAAGTTATCCGTATTTTGCCGttcaacg
ccttcaacatgttctgGTGGGTCTGCCAGAACCAGCGTGGCAACAACCAGACCATCATCCAGCAGACAGACGTACGCCTTGGCAGCTCAATTGACGCTAG
CCAGATCCCTGGCCCGACGATGCAGATCTTCAATCCGGCGTCGGGACTATTTTTTGTGCCGCTAGTCGACAAAATCATATACCCGCTGTACGAGAAGTAC
ACGGGCAAGCCACCAAGCAGATACGGCAAGGTGTTGGCTGGTTATATCGTGGCGATAATCGCGATGCTCTGGACAGGGGTTTATGAGGTAATTCGCCGTA
ACTCTCCGCTCCTAACGTACGTGGATGGCGATGGTGAAACCCAGTACATCTTGAACGACGACGGCCTCCAGCCCATGAGTGACATCCCGTGGTGGACAGC
TATCCCACAGTACTGCTGGGTGTCTTTGGCGACGGTGTTTATTCAGATCTCGACGTATAACATCGGGTACACTGAAGTCCCGTTGAGTCTTTGTGGCATG
TCGATCGCCCTTGGGTTCTTCATGAACTCCATGGGCAGCACGCTGCTGTCTGtgtttgtgttgctgtttggCAAGTACATCCCTACAAACCTGAACGATG
GTCACATGGAGTACATGTACTTCGCGCTCGCAGCTGTGATGGCAATCAACACCATCTTTTACGTCCTAGTGATGAAGGAAATGCAGTTCGCGATGATTCC
ACCGGTGGGTAAGGA