Description :
From Genome Similarity Track
Location :
scaffold_83:41793- 45651
Transcript NameFunction/comments
g3067.t1 conserved hypothetical protein
g3068.t1 hypothetical protein PHYSODRAFT_345492

Sequence
3858 bases(100 bases per row)
GGCGCAGCGAGAGCTCCTGCATGAACTCGTAGAGCGCAGTCGCGAGCGCGTGGTGCAGGTGCGCGCTGGTAGTAGTCTGCTCCACGTCCTGCACCAGGAG
CAGCTGAAAGTTTCTCCCCCGTTTGCGACCTCGACGTCATTGCCACTGCTGCCTCCCGCCCCCACACTCGCAATTGCAGCCAAGCGCCGAACGCACAAGA
GTTTCCATGCAGAATTAGCAGATGGCGAGCACAAAGCTCGACGACGACGTGGAGCGCTGCCACGACTCGCCAAGGACGTGGTGCAGCTGCCCGAAGGCAC
GACCTCCTTCGAGCAGTATCAGAACTTCCTGGCCAACAAAATCTACAAACAGGAGACGATGCACCTGCAGAACCGTCGGGCGGCGCTCGTCCCCAAGGCA
GATTTGCTCAAGAAACTGGCGACGGTCTGTGCTGCGGCGTTGAAGGAGATGGAGGACGAGGGGGACGCTCCGTCTGTGAGCGAGTCTCTGAGAGAGAAAC
TGCTACGAGCTATGGCACTGCTTCGAGGAGGACGAGCTTTTGAGCAAGCCAAGTCGCTGGCACCGCCCTCGCCTCCTGCTTATGGAGAGATAAAGAACGC
CCACCTGGCTTTCCTCCAGTTCAAGCACGATGAAGTGAACGCAACGAAGAAAAAACATGTTCACCCGTGGGTATTTATTTGCGCTCATAGGGATTTCGTG
TTTCCTACTTACGCTAATACGCTTCACTTTGTACGGTAGGAGTGCTGGTTTGCAGGATGGCAATACGTCGACCAAGACTCCGATTCACTTTGGTGATCAA
ATTTGCGTACTCTCTTCGAGCTCTGACTTACCCCTCGCTGTTGGGCCCGATGGCCGTAGTCGTCGTGCGCAAGACAGCTCTGCTGGGCCGCACATGACGT
TCACCATTGTGCGTTGCTCTTCGCATTCTCTCAGTGTGTAGGATGGAATTGGGTTACTAACAGTATCTTTGCTCAGGTTGACTTCCGAAACCCGTCGCGC
TGCGATGAGGTCACTTCCACAGACGATTTCTGGCTTCGTGTTGACCCTGCAGTTCTAGGACCTCGCAAATTCAACCCTCGTCGTCTTCATTGCAATGGTG
ATGACACCGATCCGTCAAATGATGGAGGTGACGGCGAGTTGTCCTCGCTTCTTAGTGACACAAGCTATTATCTCGGTTGCCCGGGGTGGCAAGACGACGA
TGAGTCTAATAACTCAGTTCCTTCGAAAAAGGCATCAATATCATCGATTCTCAGTGGACACACTCAAATTGACGAACATCGGCTGCACGAACAAAAACAC
TTTCGGCTAGTGGCTATGAAAGCTTTAACCCCATCAAGAGATGTCTACGGAGATGATGCGGCAACACGTGAATATGCTGTAGAAACCAACGAGGGCATCA
TGCGCTTGGCGCGCTGGCGGTTTGTGAGGTATACCCCACGAAAACACGAACAACTTGGCGGGAAGGCAGAAGCTGCCCACAATGGAGCTGTTGGAGGTGA
ACAAGATGTCAACGATGCTATGGTGAATTGCTCAACGGTATATCTAGTTCTGAGCGACTTTGCACTCGTCTACGATGCGAGTCTCAAACATGGTGTGGGT
GTGCGCGTGTCGCCCGACGCTTACGAACGTTCGAATGTGGCAAAGCTCCACCAAAATGGCATTGGTGAGAAGAAGGAACCTCGTCATCATCACGACGATA
GAGAAATGATCGCAAATGTGGTCCATCTTTCCGCGTGTGCACGATGGCAAGTGCGTATTTTACAGCGCACAGGTGGCGTCAATTATTTGCAGGAACTGGA
ATTGGCCATGGCGGCAGTGACTGGAGACTACCGGAAAGAGGACGGTGCGCGTGTGGAGTGGTTGCGTGAAAAGCAAGAGAAAATGGCTTCAGACAATCGC
CGGCTGCACGTGAAAACGAGGTTGGTACCTGAAGCCCGGCGCCAATACGATCTCGTTGCTGCTCAAAGCAATAGCAAGCTGGAGCAGATTGAGCGTCAGA
AGGGGGCACAAGCTACAGAATATTTTCAACGACGTCTTCACGAGCTCGAGGCGCACGAAGGCAGGCATCAACCGTATGAGATTTTGCATTTGAAACAGCA
ACAGCTTCAACGCGTTGTTGAACTCCCGCGTCTGTGATCCAAAAAAATAACCAGAGCTTCTGAAGTATGAAAACTATCCGATACATTTGCTATAAGATTC
GAACTGTTCTCACTCTTCCTTGTCTTCGCCGGCTTTGGCTGGCTTTGCATTGCCGTGCTTCTTACGCTTCTCGCGCTTCCGACGCTTGCGATTTTCTTTT
TGCGCAGCAGACAGCACCTTCCGTTTAGTACCAGCTTGAGAAGTCCCTGCTTCAACAGTACTTTCAGTGGAGGAAGCTGGCACAGGAGCTTCAGAAGTTG
CAGCAGTTGATGTTTCAACCGCCTTTTCAGTCTTTTCATCCACTTCTGCCGGGGCCCCACCAACTCGGTCAGTTCGTTCGAAATACGCCACGAAGAACCC
GTTTGTGGAGTCCTCGAGGCCGTTCGCACGCACAAGAGCCTTGGCCTGCTCAGTCGACAGACCTGCCACCTCAAGTCCACGGCGTGGCCATGAAGTCAGA
GCGGGCTTCAAAACAAACGGTCGCGTGGCTCGAATGTTCTCGTCGGATTTCAAAGCTGCAGCGACAACCTCCTCGTCCTCTTTTTGGAAAATGGAACAGG
TCGAGTACACGACGCGCTCCACCTGCGGGAAGGAGAAGGTCTTGCGCAGCGCCTCCAGCTGGAAATCTGCGAGCGATTGGAGACGTTTCGCCGTGTCCTC
CTCGTACTCGGCACCGTGGTCGGGTTCCAGCACCGTATCACGTGAGCTCGCAATATCCAGCAAGTGATCCAAACGGTTTGTCATACCCGACCCAGAACAC
GACGGGTCCAGCAGAATACTGCGCACGTTGCGATACATCTCTCCGTCCACTGGTACTTCCAGGAAGCTCTGGAGCTCCGCCTGGACGCGCGTCGCAGCAC
CTGCAAGCTTCATTCGTCGTCTCAATAGCTCCAGCCTCTTCGGTGATCGGTCGAATGCAAACACTCGTCTTCTCGGTGTGGAGTCGTCTTCCCCGTCTCC
ATCCTGCTGCTGCAGCAGCATGGCCAGGTGACTGGTCTTGTTGCCCGGCGCGGCACAGGCGTCGATAACGTCCCCTTCCTTGTCCTTGGCGTCCACGTGC
TCTCCATGCAGCACGAAGGCCGGGAAACAACTGGCCTTGTCCTGTAGCACGAGCTTCCCGCTCTTGACCATATCATGCTCGTGCAGTTCCGTGCCCGAGG
GCAGCACGAGCAGGTCGCGCACGTCTCGGTCCTGTTTGGCATCGTATTCCTTCGTGAAGGCCTCGGCCTCTTCAGGTGAAGCCAGTAGCGTATTGACGCG
TACGTAGCGAGGCAGTGCGAGGTGCTGCTGGCGGTTCTCCGGCGGCAATAAAGCCTCATTGGACGCCACTTTGCGCTTGATCTTGAGCCTCGCCAAAGCC
GCTCGGAAGGCCGTTTGATGCTGGACGAGTGCTTTCTTGACGTATCCACCGCCCTGAATCTTCTGGCGACCGAAAAGCAGGTCGTAGAGCGCCACAAACA
CGAGCGCAGGCGGTTCCTTGGTTTCTTTAGGCGTCTTGAGCGCCTTGTGACATTCGGGCACAGCTGCCAGCAGCTCTCGCAGCAGCGGCTTGTAGCGCAG
CGTCTCGCACACGAGCGCGAACGAGCTGCGCTTGTGCACCGTGGACTCGGCGTATGCGAGGCTCTTTAGCCCGCCCTGGCGCAGCTCGAGCTTGTGCAGC
AGCGCTGCCGCCTCCTTGTAGAGTTCGCTCATGGTCAAACGCAAAAATGGCTGGACGC