Description :
From Genome Similarity Track
Location :
Scaffold_5:41790- 48350
Transcript NameFunction/comments
Physo_155480hypothetical protein
Physo_155482hypothetical protein
Physo_128515hypothetical protein

Sequence
6560 bases(100 bases per row)
GCAGTCACGGAGATGCAGCTCGCCTTCTCGGAGGGCGGCTTGGTCGAGGCGAGCTCGTCCACCACGCCGGCGCTGTCCAATCCGTATAGCGCCTCGATCT
CCGTGGCCGCGGACATCGTCGTCTCGGTCTTCTTCTTGCTGGCCGTGGCGATTCAGCTACGTAAAATCTACCGCTACCGTCGAACGGGGATCCGCAACGT
ATTGTGCGGAGACGTCTGGACCGTCATTGAGCACGCGTCCACGTTGGTGGTGGTGGCGTTCTACTTCGTGTGGTTCTCCATCGTTCTCCTCATGTTTCAG
AAGAACTTCCGGGACAACTTGGCGCAGCTAGTGGTGGGCGGGAAGAACTGGGCGTCCGACACTGAGGCGCGCGGGCGGCTCTACGCTGTGATCGCCATGC
TCCAGCAAGTGGCGCAACTCACCGTCGCGCTGCGCTTGATCGCGACGCTCGCGGTTTTCCTGCTGAGTCTGCGGATTCTGAAGCGGTTCCGCTTCCACCC
GCGCCTGAGCATCTTGACGCGCACGGTGGCGAACGCGCTGCACCAGTTCGGCGCCTTCTTCGTGGTGTTCATCGTCATCTTCGTGACGTTCGCCGTCTCG
GGCACGATCCTCTTCGGGGACCGCGTGGAGGAGTTTTCGTCTATTCAGATCGCCATGGAGACGTGCATTAACATGCTCTTCGGCAACTTCGACTACGGAA
CGATCCAGGGACTCTACCCGCCCGTGTGCATGTTCTACTACTGGGGCTACATGATCGTCGTGAGCCTCGTGCTGCTGAACATGATGCTCGCCATTGTATT
GGACGCGTACGCGGAAGTGAGCAGCGAGAGCTACAAGGCGTCCAACAATTTGTCGCTATATCGGATCGCGGATAACATGCTCTGGGACCTACTGTGTTGG
CTGCACGACGTCATCAAGTGCCGAACCCGTCGAAACAAAAAAGAAGTGTCGGCAAAGACTGCTCCGCGTGTCAACCAGGCGGCAGCGAGGCGCGCTAACG
TGGAGTTCGCGGAGCTCGGTCGAGTCGATGTTGTTTTCCGCGGACGAATTCGACCGGATCTGCTCGAGCACGGACTGAGTGCAATGCTGGAGCAAGCGGA
CGCATCTACTAGTCCAGACTCAAAGCCATCGAGTGCTCAGCCAACTACGGTCACACCTCGGATGTTGATGGAAATGTTCCCCTCAGCCAACGTGCAGGAG
CATGAAGCTCGCGCTACACTGCAGCATATTCTCGATGGGTTTGATTCTCCAAGTTCGAGCGACGTAGGAGACACTCCGAACGTCGTGCAGCAGAAGCTTT
CAACGGTGGCAACGGATACTGACGCCAACGTCCTGAGTGATGATGACGACAGTACCGCTGTAGTTCACCCAGTCCCAACACCACAAGCAGGACCAAACTC
GGACGATGCTGCTGTACCCCTGAACCAAGACTTCACCAACGTTGCGGAGAGCACTGAAATTCAACGGATGGCTGCACAACTTGCTGCGCTCGAGCACAAA
CTTGATCTGCTGCTGCAGCGTTCGCTCTGACCGTCCGCCTGCCGGTCGATTGAATGCCATTCAACCTACCCATTTTATCCTCTGCGTTTAGTTCACGCCA
ATTCCATTTTAATCTTCATCGTCATCCTCTTCAGGCGCCGCATACTTCGCGCGCGCGTCCAGCAAGCTCTTGAACCGCGCGTACAGCCTCGAGATGCGCC
TCTTCTCGGCGCGTTCGGGGTCGAAAAACAACGCGGACGCAGACTGAGGCGCGCTGTCATCCTTGTTCAGAGCTACCTGACTACCTCTGCGAGTTGCCAG
CGTTGACATTCTTCGCTTTGGAGTCGGCTCCGCACTCACCGCCACTTTGTTCGACCCGGACGACGCTGAGGTCCCAGCTGTGGCGATCACCGACGCACGG
AAGGCCGTTCGCTGCAGCACTTGGCGAACGCGCTGCCGCATCACTAAGGGATCATTTGCAACTTTCACGGGTGTCTTCGCCACGTACACGTGCACGCGCT
CAATGTGCAGAATGGCGCGACCTTCGCACTGGATGCGGACGAATCGGCCTCGAGACTTCTGCGGCGCCACCCAGTCGATCGGCGGCGCCATCTTGTCCGT
GACGCACAGCGAGCTCACACAACTCGCAATGATGTCGTCGCAGTCACGGCCCACTCCAGTCTTCATCGATACGCTGATGTGCAGCGGATACACGCCCGTT
GTGTGTCTGCCAGGATTCGCTGCCAGCCCCCTTGCAGCCGCGTACAAGTGGCTCACTTCGTCTCGCAGATAGACTTTGACCGAGTGCACCTCGACGTAGT
TGGCGAGGTCGATCTCCCACCACGGCTGGAACTCCTCCTTGGTGTGGGCGGATCGATTGGTGTCCGGGTCCAAAGCGTTCTGCGCCTTCATGCTGCAGAC
AGTGGACGACTGGCGGACGCGCTTCTTGACTGCGATATCCTGCAGGTTGCTGTCCTCCGTACGGCTCGAGAGCTGCTGATGCCATCGACAGAGGATTGAA
TCGTGGATCATGCGAGCAACTTCGGCGTCTTTGTCGGGGTCAACGATAGTCGAAGCCGACGGTTCTACCTCATCTAGCCCATAATGGAGTTGTTGCTGTC
TTAAGCCTTTGGAGTCCGTAGCATCCGATGGCTGCCCGCTCTCCTCGTACGCCAAGATCTCCTGACAAAATACGCACACGTTGGCTGTCGCGTATAGAGC
TGATGCGGCGTTGTGCTTCTTGGAGTCTTGGATGACGCCCCACTTGCGGCGGAGATCGTAGATGCGCTTCATGAGCACCACTCCGGGCAGGCTGGACCGC
ATGAACCTGCGCTCGCATAACGCACACGGCGCGCGTGTGGGTGCCCACATATTGCCATTCTCGAGCTGTCGTTTAGCTCTGACCGGTTCTGGATTCGACG
GCCTCTTTGACGACAGATAGCAAGGCGACGAGGACGGCCGAGGCTTTACTTGTCTAGGGGCTAACTGTCCGTCTTGGACTGAAGCAGTCTGAGGAGGGTC
CATCGCCTTCTCGAAGTGCAACAACTTGCCCCCGTAGCTCATCGTCACCCAGCCAGAACTTTGCTGCGTCGCACTGGCTGGGCGTTTGATGAGTTGACCA
GAGCTCAATGCTTTCAGCTTTGCTGCGTGTTGGTTCGGCTGGGAGGCAGCGTTTGGTGTCGAAGTGACTATACGACATTCGGTGAGCCCCTTGTTGGAGC
AGGTTGCGCTTCGTGTCCCCGGTTGCGGAGTCTTGGTTACGGCGATTTCACTCTCTTCGGTGGCTCTATTTGACTCAGGGTCGTCCAGCTTCGAGTTTGA
CAGCGCCGCCTCTACATTGGCAGCGATGATTTCTACTAGGAATGGAGACGCGTAGTCGGCTTCGTCTTCTTCGACTGCAGAGTCAACAGCGCGCTCCTCG
CCACGAAATACTGGACCCATATCTCGAATAGTGAGGAGTTCTACGCCTACGCTTTTGTCGAGTGCCTGGAAGACCCACGTAGTTCCGAATCGATCACGAC
AAGCCCCTATTAAGGCCTTCTTTTGGTCGATTGCGTCTGTCAGATGCGCGTGGTGGAGTAACTGGAGTTCGTGAGCACATTGGGAGAAGCTTGAATCCTG
GCTCTGCGAGGACCCTGAGGGCAACGGCGGCGTCCGAAGTCGGAGCAAAGCTTCACAAAAGTAAATGGCGATTTCTATCGGTCGATTCGTGTCGTAGGTT
TAGTCATATTTTCAACGAACAGAGTACGAACAAAGAGCTTGCTTACCAGGGTTCGCACCCAGCTTGTAGATGTTCATTTCACTTTGGTAGTAGATGGCTG
TCCAACGAGCCTCGTAGGCACCAAGATTCCATCCATGTTGCTGCGAAAACCTGCCAGTATGAGAGTGGGTAAATCGTCAAGTATAAAGATGTTGAATGGA
GAAGGCAGTACCTGGTTTGCGAGCAATTGGATAGCAAGGAACTCGCCTCGTGAATTAGTGTAAGCGCTCGCCTCGCGCATATGGACCCGATTCGTGATAA
ACGCTCCACTTTAATTTCTGTAAGGCTCAACTGAGCAAACATTGACGAGAAACACCGTTTGTTGGAGTTAGTGTGTAAAATTCGTGGAAGCAAGGGGGTC
TGAACCAACTTACACCCGTTAAATGGGTCGATAGTCGATGGGTCGAGCACAAGCGCGAAAGAGCAGCAGTATTCACCGCCATCGCGTCAAAGAACTTCCA
AATTGGCCGCGTCGACGAGTCATTCGGATCAATTTCTTTCGTGACCATCTCTTGTGAATAGGATGCCGCCCAACGGAAAAAGCTTTCGGCACTCTGCCAG
GAGATCTCCGCGTGCTGCAGGTTGGGCCAAGCAACTATCGTTAAGGCCTCTCCCTTTTGCCTGACCTGACTTTCGGCGTGTAATGCATGCAATTGTCCCA
TTGAGCACAGCACGAGCACCAGCTCGACTGGAATGCAAAACGCAAGACACTGCTGCTTCCCGACAAGTCTATCCGATAGTAAATCCAAGTCGCCAAACCC
GTAGAAAAGAGGTGGGAAAATGGTGAGGAGGTACGGCAATTGTAGTGTCGGGGCATCGGGTTGTCTTCCCGATTGATATCGTCGAATTGATAGCAGGAGC
GGCAAATATTCATCAAAGAGCTCGAGCACGTCCCAAAACGCACCCGGAGACGGAGCGGCAATGGGAAATTCCTTCAGCCTGAGGCGGATCTGCGTGCATC
CGCCAAGAACAAGTTAACTTACTGTTGTCACTCGAATGATTCTCTCTCTCTCTCCTCACCTGCATCCGCAGGTCAGCGAATCTGCATGAGTCGAAGTAAA
GCTCGCTGATTTGTTTCTGGGAGCGACCGAAAATTGTTAGATAGGACGCTTCTGCATCTCCCTAGTTCTGGAAGGAGGGCTTTGAACAAACCTCTAGTGC
CGCTTCTTCCTGAGTGACGAGGTGGAAGCTTGGGAGCCGGCCACTCCACAGTCGCGTATGCATCCACTTCGCCGACAACATGGCACCATGCCACACCATC
AAGCGGCTGAACGTATAGCAGACGAAAATACTTGCCCGGGGTCAGACGAGAGCGAGTTCAGGGGTATTTTCGAGCCGAAAGACTGTGTAGTGTGAAGAAT
AGAATGAATGAGCTATTAGAATGGAGCAAATGAGCTATAGGCAACTCCGACGAAACACTGTGAGTGCTTGTTCTAGCGGGTAAAAGACTTGTATAACTTT
GCAAGGTGCGTTTGACGAGAACCGCTTCCAGCAGCCTGTCGAGCTTCTCTTCGAGTCCCGCCACTTGTTCCGTCAACGCTGTGATTTTCTCCAAGCCCGT
CGACATGCCAGAATCTTCATTCTCCTGTTCCTCTGGCTCTTCTTGTGAGTTGCTTGGAGTAAAGAGGGCCCTCATCTTCGCCATAAACTCGTGGCGGGCC
CCCTCGAGCTTGCGGAGGAACTCGTAGAGCATGTAGCCTTCATTGCAGAACCGATACGTATCGATCACTTCCTGGTCGCTTGATCTCACAAGCTGGGAAC
ATGTTGCGAAGACTCTCGAACGTGAACTTCTTCTTCAGGAACGAGGAATCGTCTCCAGTGCGCTCTACATCGAGCTTCCTCATCGCTACGAGCATCTCCA
GCAGGAAGAACGGGTGCACTCTTCCCTCCCAGATCAAATCTTCGCGCGTCAACCCGCGGTTGTCGAACCTGAGCAGCTTGAAGATCTCCAATTGCTCTTT
CTCGGCCTCACCTGGCTTGATGAGAGCTGGATGGCCTTAAAGCAGCGCCACGGCAATGCCGTTCTTCCTCCCCATGAACAGTAAGAGAAGATTGGTCCAC
AGTTTCTTGCTCCTCCACGAGAGGAACATTGTGAGAGCGTCTTCGTGCGCCTCTTTGTTCATGGCTTCGTACGCGGCCATGACGATCGCCAGCATCATGC
TGAGCAGCTCGAGACTCACCACCAGCATGTAGACCCAGTAGAAGAGGCTCGAGGCTGAGATCTCGCGAATACTGTCGAAGTCGAACTCGCCGAAGAGCAT
GTTGACGCACGACTCCATGGATTTCGCGGGAGTGGAGAACTGGAGCACGCGCTTGTCGAAGAGACTGTGGACCATGAAGGAAAAGGCCAGGAAGATGATC
ATGAAGACGAAGAAGGAGCCGAAGAACCGCCGGAGAGACGTCTCCACGGTGCTCGCGAAGATATTGAGCTGACGGTGGAAGCGCATCTGCCGCAGCACGA
AGAAGCCCAGCTGGATAATGGTGACGGCTCCAGCGAACGCCAACGCATTTAGTTCGACGACTGCGCGGTCAATGGACTCAAGAAGTTCCTTGAAGAGCCT
GGAGTTTATCTTGCGAGTCGGCTGCATCTGCTATCCACGACAACTCGGTATCGAAATTCATGGTCAGCGCTTGGATCAAGAGCGCGAAGAACACGGGGAT
GGCTCCGAATTCAACGATAAACATGACTAGAGAAAATGCCGCAGACACAGCGTGTTGTACGAAGCTTGGCGTTGGCTTGTTGGCTTGCCGCGCTAACTCC
TTTTCTGGGCGCTCCAGGAAGAACATGCAGACCCCGCCGACGAGGAAGACGATGACAAGC