Description :
From Genome Similarity Track
Location :
Scaffold_200:41790- 43616
Transcript NameFunction/comments
Phyta_totarag5479hypothetical protein PHYSODRAFT_553558

Sequence
1826 bases(100 bases per row)
CATGAGCTACCGCGGCATGAACCCCAACGCCGAGATCGTGAGCAAGTCGCAGGCACTTATGGTCAACGTGAGCGCCGCCAAGGGCCTCCAGGGCGTGCTC
AAGTCCAACCTTGGTGCGTGCGTCCGTCTccctctccatctccaacAGACTGTCCACAACCAACACATAATACTAAAGATCTCCATTTCTAACAAATGTT
CGCCATAATAATTACGATACACAGGCCCTCGTGGCACACTCAAGATGCTGGtaggcggcgctggccagATCAAGCTCACCAAGGacggcaacgtgctgct
gcacgagatgcagatccagcacccgacggcggcgctcaTCGCCCGCGCGGCCACTGCGCAGGACGACGTGACGGGCGACGGCACCACGTCCACTGTGCTG
TTCatcggcgagctgctgaagcaggcgGAGCGCTTCCTGGCCGACGGCCTGCACCCGCGTATCCTGTCGGAGGGCTTCGAGCTCGCTAAGGACGAGgcgc
tgcgtgtgctggaCACCATGAAGACCACGCCCGAGGACATGCTCAAGGACCGCGAACTGctctgcagcgtcgcgcgCACCTCGCTGCGTACCAAGCTGGA
CCAGAAGCTGGCTGACCAGCTGACGGAGATCATCACGGACGCTGTGCTGACGATTGCCGTGCCGGAGCGCCCGATCGACCTGCACATGATCGAGATCATG
CACGTACGTGGCGCGTGCTTGAAAAGGTGGCTGCTATTTGCTGAGGAAGCTGACGGTTTTTACGGTGTTGATTGGAAATATTCAGATGATGcaccagagc
agcagcgacactCGTCTCGTTAAGGGACTGGTGCTGGACCACGGCTCGCGCCACCCGGACATGcccacgtcgctggagaacTGCTACATCATGACGTGCA
ACGTGTCGCTGGAGTACGAGAAGAGCGAGGTGAACTCGGGCTTCTTCTACAACAGCGCTGACCAGCGTGAGAagatggtggaggcggagcgcAAGTTCAC
GGACGACAAGGTGCGCCAGATTATTGAGCTGAAGCGCGAGATGTGCacggaggagaacaagaaaaGCTTCGTGATCATCAACCAGAAGGGTATTGACCCT
CTGTCGCTGGACatgctggccaaggaggGCATTCTGGCCTTGCGCCGTGCTAAGCGCCGTAACATGGAGCGGATAACGCTTGCTTGCGGTGGTATGCCCA
TCAACTCGACggacgacatggacgagTCCATGCTGGGTTACGCCGGCAAGGTGTACGAGCAGACCCTCGGCGAGGAGCGCTACACGTTTGTGGAGGATGT
GCAGCACCCGAAGTCGTGCACGATCCTGATTAAGGGGCCGAACGAGCACACGATTGCGCAGATCAAGGACGCCATCCGTGACGGTGTTCGCGCTGTCAAC
AATGCCGTTGAGGACAAGGGTGTCGTTCCCGGCGCTGCCGCCTTCGAGCTGTCTGCCCACGAGGCGCTTAACAAGTTCAAGGGCACGGTGAAGGGCCGCG
CCAAGCTCGGTGTGCAGGCTTTCTCGGACGCTCTGCTCGTGATCCCTAAGGTGCTGGCGGAGAACTCGGGTCTCGATGTGCAGGACACTCTGATTGCCGT
TCAGGAGGAGCACCAGAATTCGGGCATGCCTGTCGGCATCGACCTCTTCTCGGGCGAGCCCATGCTGCCGGAGCAGGAAGGTATCTGGGACAACTACCGG
GTGAAGCGTCAGTTTATCCACCTCGCCACGACGCTGGCTTCGCAGCTACTGCTTGTCGATGAGGTTATGCGTGCTGGCAAGCAGatgggcggcggcggtg
gcatGCAGCCCGAGCAGTAGGTAGGG