Description :
From Genome Similarity Track
Location :
Scaffold_124:4179- 7541
Transcript NameFunction/comments
Phymu_g4909hypothetical protein

Sequence
3362 bases(100 bases per row)
TCAAGTCGGCGCATCGAGACGGGTGCCCTTCAGGACCATGCGAATTTGTGGATGGTTGGTGGGAAACTTAAGAGTAGCCGCCTGAAAGAAGTGCGAGATT
CCGTGGAGTGTAGCCACAATTGGCGTACCGCGTACTGAGAGCCCCGAACCGTAACCGTACCGAACACCATGAAGAACGAAGGCGGTGACCACTTGGATCT
AAGCATCTAATGTGTGCTTGAGGAGCGTTGGGTCAAGCCCACGTCGGCTGTCCAGGTGTACCAGGCGCGGAACGCGGCGCGTACTTGGTGTATGTTGACT
GTGTGACCGAATTCTTTCGGAGATAGAGTCCCAGATCGCCTCCAAAATTGATACATTCGTCGATAGGTTGACCTGCACCCAACCACGGGTTAGTTTATCA
TATAACGTGGCCATAGGTCTACTGCCATACGACCGAGAGCCCGCGTCCGCGATCCAGTTGCACGTGAACCGCCGAGAAACGGAGGCCGAAATGGAGTTCT
CAATGACTGAGAAGGCGAATGATGATCTGGGCCCGGGGTTTGGGCGAGGCCATCTTGTTGTGCCATGCCACAGGTATTGTTAATCTTTAACTCCACGTGT
ACAGGGGAGGTGACACCAGCCTTCCGCTGTGCAGACCAGCGCTTTCCCCACGTGTGGACGGCAAATGCGCAGGACAGGAATTCGCGGTAATTGATATAGA
AGCCCACAGTTGGATCGGTTTTAATTGACAGGATTAAACCCCGCTCCACCTCGGAAAACGCATAACATAGAATGCATCGATCCTCGGCCACCAGAGCACA
CAGAGCAGAGTCGAAAGCGTCCATTTCGAAACAGACGTCCGGCGCAGTGTTGCTGTGGAAGGATTCAACGGGAACGCCGTTCAATAAGGGGGATCGAAGG
ATGATAGACCACCAAGAGAGGTCTTGCTTCATCGCCGCCGTTACAGGTACGCGGCCCCACCGATGGAGGTGTCGCTCCCGCTGGCGGAGGCGTTGGAGGA
ATGGGCGTGCGGGCCTAACGCATGTGCCCACATGGCGTAGGCGACCGAGCAGAGAACGGTAGTCCGTGCGGCTCCGCGAAGTTGCCCGATACACAGCATT
GACGCAGGTCGCGGCCTTTGTTATCTTTGCAGCAGGCATAGACACCGTCCCGGTGGCCGTGTCGAAGATGAGACCGAGAGCTTTCTGGCAAGTGCTCCAC
GTGGTAAACTTGTCTTGCGTTGACAGCAGTGGGTCCCAGGATAGTCGTCATGGCAAAGCGAAGAGACTGCTCCGCATCGTTGCAGTTGGAACCGATGTCA
GCAGCGACATTGATATGATCATCGACCCAATACCAGCTAAACATACCGTCAGGTTGTTGGTCGGTGGTCGAATTGCCGTGGACGTAGGCAATTGCGCCTC
TGACGATGTCATAAGTTGCGGGGGAACCGGACCAACCAAAGGCAGCCGACGTGTCGATGACCAGCGCATTGTCGCACTCGAGCCGGCCCCCGAAGAGAAA
TGCTCGGTCGCTCTGGATGTACACATTACGGAAGGCGGCGGTAACGTCCCCGGCCTGTAGTTTTATCTCCGCGTCGGGGTGGGCTtcttggagacgaagg
aTTTCCACTGCGATAGCGTCGCATCGCTCGAACATTGGAGAGCAGATGGTTGAAGTGTTCGTGTAGTCATTGAGTGAGTGCCCGACAGGGGATGACAGGT
CATGTATGGTCCCGCCTGATGTAGACGGGTCCAATTCACCTTTGTCCACGACTCCAAACGGACTGATATGGACTTCCCTCCAGAGCATGAGTATGTCGGC
ATCGAGCACGAGGCACCTCCAAGTGCCTTGTTCTTTCCGGACATTCCTTACCAGAACCGAGTATCGGTCGTGAGCAGATTTATGGTTGGCCGGGGGCATG
CTTTGTCGCGGTAACGGGCTCGAGAGCGGCACCTTAGCTCCGTGCATTGCGATGTTGAGCAATCCATCATAGGTTTTGTAGCCGGCACGCATCTGCTGTA
GAATTGCCGGCACCATGTTCTTGTTTGGGCGGAAGTCTTCACGAGTCTGACCTCGGATAAGTTCGACGAACTGGCGTAATGGTATACGGGTTCGTCGGAC
GAACTCCGATAGAACGCACTGAAGTGGCTTGTTTAGGCTGGGCGTAGCAGAGGCCGGAAGTGGAGCCATCGATGGAAGTGCCAGTCCCACTCGGTGAAGT
GCCAGATCGGTGTTTTGTAGACGAATGCGTTCCCACAGGCTCGCTCTCGCCTCCGCGTTTAGCCGGAAAGCAGCCGTGCGCCCGTagcttggagctggat
gcCTCTGTGTGAGCATACCTCTCAGAATGCACTGGAACGTGTTGTGCGTCACATCGGTGCCGGGCGTTGTGGGCCCGCTGCCGATAAACGGCTCTGTGGA
TGGGAAAGTGCCCTGGGGCGACTTAGTGCTAAGAGTGCCTTGAGGCGACTTCGGTGGAAAGGTAGGACCATAGGGTGCCTGTGTGTGTGGTAGTACATAC
GTACTAGCACTAATCGCAGTGCAAGATCCACTGAACGGGTCTATGCAACTGGAAAGCGGAGATTGTTCGTTTGCAGTACCAAGATGTTGTGTATTAAGCG
TGGTATTGCATGCGATCCGAAGTGCCGACGAACGGGCAGAGCCTCGGCCGCTTCAAGAGCGGTGTCGGCGGTTCTGTTGGCGACGTTCCTGTCTATTGTT
GCGGTCGATGAATTCTTGAAGGCCTCGCGGTAGCCGGCCTTCCCAGTGATGCGTGCGGCGGTGGTGGACGCACCGGTCCGCAGACCCCCATAGCACATGC
CACCCGCCATGAAAAGGAGGCAGGGCATACACCCCTCGCCATTGCGTGGGATTAGTCTACGGATGTGGTCCGGCATGATCGGCACCCGAGCGGCCGGTCC
ACGCCGTTGGaggtgttgctgctgaagaggctgGGTTGGAGGATGCGTGTCGACGGAGCTCACGGTAGTCGTCGTGGCCACGCGGAGTGCGAGGCCATTA
CGTGCCGCTTGCCAGTCGGGACTATGGTAGTCAACGGCGCGAACAGTGTCGCAGAACTCTCGCCACCAATATGGTGAGTCCACGAGCAGGTGGGCTAAAG
CGCGGCCGATAAACTGGTTGACGTACATTAATGTCAGGGTGACACGCTCCGGGGTGTTATTGTCACACTCCATATTCGCCAACACGAAACGCTTGACCGC
GTGAAAGCAGACGTCGTGCGTGGTCAAACCACGCGGCATCCTCAAACGAAATCATCCCGCTAATCGCGGCCAGTAGGTCTTCGTAGGACGAACACTGGCA
TTCGTAGCCGGCAGTGATGCCCCAGCTCCGAAATCGGCAGAGAAGTTTGCATTGGATGACCC