Description :
From Genome Similarity Track
Location :
Scaffold_25:41784- 64557
Transcript NameFunction/comments
Phypl_g1045hypothetical protein
Phypl_g1046hypothetical protein
Phypl_g1047hypothetical protein PHYSODRAFT_345503
Phypl_g1048hypothetical protein
Phypl_g1049hypothetical protein PHYSODRAFT_491946
Phypl_g1050hypothetical protein PHYSODRAFT_497615
Phypl_g1051hypothetical protein
Phypl_g1052hypothetical protein PHYSODRAFT_354318

Sequence
22773 bases(100 bases per row)
GGGCACTATCTGCTGAGCTTCGATGCCTAGCATCGACTGGTAAAAGTCAATGGCATCGCATCAGAGCCATCGCCTTCCTGAGATTCGTCAAGtgtcgacg
acgcggagTTCACgtcgcccccccccccctccccctctCGCCCGTAGCCCAGAGGCAGACCCTCATACGCCAGCCcagccacctcctccagcttaTTGTG
CACTCGTCCTGTCAGCCGGTCAAACATCCTGCCACTGCGCGAGCCAATTGTTGGTGTTTCCGGGTAGCTGACCAGCGTGCAGGACGTCCCCTCCAGTTTC
CCCAATTGCTTTCGTATCGGGAAGGACCCTCGCTTCCAACCCGGGCAAGCCGAGCAGGGGTCCTCGTCCGCTGAAGGAGTTGCTTCAAGTGAAGCCTCTT
CCGGTGCGACGAACATTGACGACGCCATTTGGGGGCGACAACTTCGAGTACAGCTGGACCACTGCACTGCCTCAGGTGGTGCAAGCTTCGCAAGGACACG
AGCTAGGACTCGATTAGATATTGAGACCAGCAGGGGCTTCGTCAGCCTCCATCCCAACGTGACGGTAAATTTAGGCGGGGCGGAAGCTCTATGAGGAGCA
TTCCAAGATGCCGCTAGCGACGAGTGCCAAGCCACCGCCCGCTCTGACGTCCAAGCCGCGCGCTCCGTTGTCTGCCCGGCCTGGGAGCGGGTCGGCCACA
GTCGCCAAACGGCGATGGAACGCGCCCCCAGCAGACCTCTTCCCTACCGCTACAACCCCACGGGTGGCATCCAAGAGGGATGAACGcccagcttcagcaa
ctgTCAAGCATTTGCCTCATGTGCCAGCAactcgaacagcgccgcAGGATCCTCGAGAGCAGTTCCGAGCTGCCATGGCATCAACCCCTTCCAGTGCGGG
ACGGAGAGACTGTAAGAAGGACCCGCAGAGCCGCAGCCGGCAGCCGGAGGACGGCCAAGTCGTAGTCAGCCCTCCAACAGGTCGCAGGCTCTCGCAACCA
GCGCGGCTTCATCGCGACAGCGATGGGCTCCAGCCTCCCACAAAAACCGACGTCGTTGTTGGAACACCAGAGAGAGCAAGTATCACGTCGGCCACAGCCT
CACTTCGATCGGATCCAAAGAGACAGCAGCTACTTGCACGGGAGGCTGAAGTAAACGCCATGCAGAGTGAACGTCGTCGGGATCCGCTTCACAGCGCACA
GGTCCTGAAGAGCCTacgacgccaagacgttGAGACCGATGACGTGAGTCCGTTGATCGAAATCATTTACTGGTCACCTTTCGTGGAAGTCCgtcgcgac
gctgctgctgcgattgccTCTCTGAGCCGCAACAGTAAGCACACTCTGCACGTGTCTAGCGTGTTGTACGCTTGCTTGGCTAACTCGGGCTGGTTTTGCT
TTTCTCTCTCTTGAAAATGCAATGCAGCCGCGAACCTGGACCTTCTTGATCAAGTTGGTACGCTCGGGGCGCTTCTGACAATGCTGAGTTCACCGGTAGA
TCGAGACGACCCAGCGATCTCCCATGACTGCGCACAAGCATTGGCGGCTCTTGTGCGATTGCCCACTGTCAAGACCAAGCTTCTCCAAGCACCAGGTGGT
ATCGactgcgtcttctccttgctgCACACGTCAACAGATCAAAAGCTGCGCCTGGCAGGTTTCGAGGTCGTCGCACGACTGGTGACCACCGATGAGTGGC
GAGAGGCTGTGGCCAAACGAGAAGGCTTTGCGTTCATACTGAGCTGCTGTTCCGGTAGTGGTGCGCCACAAACTTCAagaggtggagcaggagatgcACG
CACACGCGCCCTGGCCGCTTCAGTCTTGCACCAACTCGCCGCCACGTGCGATAACAGGGTGCTCTTTTACCATTCAGGCCACTTCACGACCCTCTCGGGG
CTGCTACGCGATCCGTTCCTGGATAAAGATGCAATCTTCCGCCGTGAGCTGCTGAGTTTCGTGCACTTGCTACTCTCCGAGGTAGAAAATGCTCGTTGCT
TTGCTTCGATTGGGCTGTTGCCTTGCGTACTGAGCGTCCTTGGTCGTAATTCATCTTGCGCCACCAGACCATCGCTTCAAGTGAGTCTGCTTGTGGTAGC
CATTCTTGATGCAGTCGcgaaggacgacgccaaccaCGGAGCACTCGTGCAAGCTGAAGCGATGCCGCGGCTTGTTCAGCTCTGCTTCTCTTCCAACGGT
GGTGTACCAGTTACTGATCCAGATAGCAAGCGCCCACACACTGCGtcagctgcaccagctcagTCCAAGGCGTCCTCCTCACGGCCTGGATCAGCTTCAT
CTACTCGCTCACGCTCCCGTTCGTCATCGATTTGGCCAGCCTCAGAGGCAACAGCAGTGATTCGCGCAACACTTGGAATTTTCTGTGCCATGGCCCGGAA
TACAGCGAATCGAGAGCATGTGATTCGATCCAAGGTGCTGGATCATATTGCAGCACGTGAGCTGTACGCTTCTTCAGATAAACGCGTCCGCCGTGCTGTT
ATCACGCTACTCACCTTGCTAATTTGCACCGAACGCAAGCGCCGTCAAGAGGCTGTCAAGACCGAAACCAAACCGGCTACGActcctgcaccagcatctc
cgcGGGAATCAAACCAAGCTTCCGAGCGCGATTATCAGCACTacatcgagctgctggcacgTGGTGTCGTCAAGTGCTTATTTGGCATCCTGGCGGGTGA
AGACTTCGGTATGAAAGTGGATGCACTGGGTGCTCTCGCACAACTCACTCATGACGCACCCTCCCGACTTACTCTGTGCAAGCCCGCGCTACTGTCAGCA
TTGGGTCAGTTCGCCTTCCACCCGCTTGCTTCTACGCGACTCCACGTAGCCCAGATCATCGCCAACTTTGCCGAGCGCCCGGAGAACGTGTTGAAGCTTG
TGGATTCCGGGCTCCTGCCTGTACTTGTAAGGTACGTGAGTCCTCTGGATCGAACTCATGCAGTCGGTCACAACAGTGACAAAGGTATGGGCGAGGCCTT
ACTTGTTGAGGCCACTCGTGCACTGGCAGCCGTGTCCGAGCTGCACGTAGCACGCTCGAGGCTAGTGGAGGGCGGCGTGCTGGGTGCACTGATGCGGTTG
ATTCGAGCGCCATCAATCCGATCGGAGGTCCGATCTTATGCCCAGTCGGCTGTACGCAACCTGCGGCACGATGCGGCGGCGTTGCGTATTCAGGCTATCT
ACCGCGGCTGGCATGTCCGCACGACTTTCGCTGGTTCGAAACGCAGACAGAACTTCCGCAAGCTCTCCATGCTGGtagaagcagcaacagcacccATAAA
GCAGCGTTAGAACAGTTCATCACGAGCCAACCGCTTCACAAATAACACCAGCGCTTGTAATGTCCACGAATTTTGTTGATCACACTGTTGGTTGATGCTT
CATCGTTATTGCTGGATGGAAGTCGCTGATACGTGTCCAAACAAAATCTGATCGTGGGCAATCTAAGCCTTGTACACGCGCGTTCCCACGGGGAAGCGCA
CGTCCATCAGCCCGGTAATACCCGCCGTAAGTACCTGTAGGTAAGAAGGCCATGGAATCCACAGGCAAGTTAGAGCAAGAAAACAACGGGCGAAATTCAG
CAACAGAGGCCTACGCTTCCAGTCGGTACCGGACCAACTCCTTCCGGAGTGCCCGTGATGAGCAGATCTCCTTCTTCCAACGTCATGATGCGGCTCACGT
AGGAGATCAGAAACGGGATGTCGTGCACCATGTCGCCAGTGTTGCCGCTctgacgcagctcgtcgtccaccttcAGCCACAAGTTAAGGTCGTGGGGCGA
AGGTACCGCTGACTTGGGGATGAAGTCGCTGATGGGCGTGAAGGTGTCGAGTCCCTTGGCGTGCGTCCACGGCAGTCCCGCtttcttggccttggcctgc
AGATCGCGCGCCGTCATGTCGATCGCCAACGCCTAACAACAGATAGGTAGGCACCCCACACAGATCGAATCCGAATTAGTCGAGAAGCAACGCACACACA
GGCGTGGAGTATCTGGGGCATACGTAGCCGGCGACGTGGTCCATGCTGGCGCTCTCGGCGATATCTTTGCCGCCCTTGCCAATCACCACCTGCAACATGA
TCCATCAGCCACCTACCTATTAGTCATCGCCAAGCCCTATCAACCCCCTTCATAGGAAAAGGGAAGACGTACGCCGAGCTCCACTTCGTGGTGCACCTCG
CCGATTCCggggggcagcagcacgctgccgccgctgcgcaCGTAGCTGCGCGGTCGTCAGCCAACGCAATTCACGATCGCTATGCTCTTGGCGGCGACTG
TTACCTGGTGGTTGGCTTGAGGAAGAGCACGGGGTCTTTCGGGGCCGAGGCGGCGCCCATTTCACGCGCGTGGGCCTCGTAGTTCTTCCCGATCGCAATG
ATCTTCTTGCTGTAGAGGGGGAGGTAGGGCAATTGGTGCATTAGGGAGAGGTGGCGTAGggagagagaggggggggtCATTGCTGTCGTAGAGCGCACCC
GAACTCGACGAactgcttcatcttcgtcatgtTGGAGAGGACGATAGGCGACAAATAAAATAGATCCGAGCAGAGCATACTGAAGACAAGTAGTTAACCC
TTGATTAGAAAATGTATTGCTCGACTCTAAAAGCCATCGTTCGGGACTGGCCACTGGGTGGGGTGAGGTCATGCGTTCTGCTGTACGACATCCTTCACGT
GTGCATCGCTCGCATCCGCTcttgcagcgccttggtctcgagctgcacgcgtcgtcgctcagcagTCAGTAGCTCTTCGTAGCTGGAGACAATGGCACAA
TGAAGGATGTGGTTACTTATCTAAGGCACCACCGCACGTTTTGTCGTTTGGTGCGGCAATTTTCTCTTGACGTACGGTGACGACTGCGCTCGAAGGCGGG
GAGGGCCAAGCGACGAAGGTGCAGGCGGTGGATCGCATTTGCTGGCTGGAGTGGACGCTTCCGAGACGCCCTGCGCTCTCACTCTCTGCGCTGTGGCTTG
ATCGAGCGGGTTCGCTTTGTCGCTATCGAGAAATACTGCTGCACACGACCTCTCGTGGTCGACTCGTTCTTTGTTTCTCCGGGCTGCTGCCTGTAGGTGC
GGCAACTGTTAGGTTTTGCCCTGCTATCGAGCTACAACATTCGACCAAGGTAACTAACGAACTGTACCTGGTTCTCGAAAAATACTTGTCGGACATGGTC
TGGTCCAGACGGCATTGGTTTTGGTGAATTGACGACTTGGCTCTGCGCTGCTACTACCGGTAGTTGGTCACGGATGCCATCGCTATTGTGACGGAGTTGG
CCATTCGGAAGTGGAGCCACGAGCTCTAAGGAAGTTGCGACCTCATGGTCAATGCTTTTTCCAGCAAACTGCTCGAGAAGCATGGGCTGATGCGAAGTCG
CAACGCTAACCAGTTGCATCAAGTGGCGCTGAACGGTGTCCGATGTCAAAATTTCGGACACATCTGGTCGTCTCTGCGAGGATTCACACATCGAAAGCAA
TTAGAGCGCAATACTTTTCGAAGACATTCACGTCAACCACGTACGCTTGGGTCTTTCTCGAGTAGATTCGTCACAAGAGCTCGGAACGGCGAAGAATACT
GCTGGGAAATGGCTGGCGGATGGCTGTGCAAAATCTTACCCACCACAGTACCGAGCGCCGATCCAGTGAACGGTGGAGAAAAAGTAGCgagctcgtacag
cacgcAGCCGATGCTCCACACGTCGCTTTTGCAGTCGTaggcgccgccttccagTAGTTCGGGTGCCCTAACGGCAAGGGTGAGCTGATGATCAGCAATT
ATCGCCAGGAAGTTCCGCAAAAATCCAACTCACATATAGTACGGGGTCCCGGTGATGGTTTGAGCAGAGTCCAAAGAGTTCTGTAGGAGCTTCGAGACGC
CGAAGTCGCTCAATTTTACGATcccgtcgccgtccagcatGATGTTCTGACCAAAGACCATTGCCGACGTATAGCGTGGGTTAGGGAGCCCGAGACGCCG
GAGCTAAGTGCGTGTAACTTACCTTTGGCTTGAGGTCTCTACACAATGATCAACAGCACGCAGTAAGTGGATCTGACCACCCATGAAATAAGTGCAGGTG
GAGTtgcgtacatgtatgtaCGTACCGGTGCAAAATGTGTTTTCTGTGCAAGTACTGAAGCGCCAGGACGATCTGGATGAAAATGCGCATGATTGCAGGC
TCGCTTAGACAGCCCCTACGAACAGTAACATGGCAGCAAGCAAACATGAAATACTAGTGGCGTTCTCAAGCTGCGAGGGTTCGTCCTACGTGCTCTCTTG
CTGCCACCGTAAGAACGCGTCCAGATCTCCTCCACTAGCGTACTCCATCACAAGCGCCAACTGCGAGTCATCCTCCACAAGTTCGATGAATTGTACAATG
TTCACGTGGTGCAAGTTCATCAATAGCTGGGCCTCCTGGCGGGCTGCGAGCCTTGCAGCGGCATCCTCGCTGTGCGGGATTTTCGCGGCAAAGAGCTTTC
GGTCCGAGTTCCGCCGAACGAGCACCACGTTTCCGAACTGCCCACTGCCCAGCACGGTCAGTGTTTCATACCCGTCGACATCTCGCAttctgcagcactt
ggcgtCCTCACTTGAAGCCCGCCGCAGCCGTTACGGTCAAGTGTTGAAGCTAAGAATTCCTAGCGCGCAACATGAACAAGAAAAGAAGCGGGCAGCGTGC
CTGCCGCTTTGCGTCATTTTGATCTGGTTTTAGTGTACATGCATGTATCGTTGCTCTATTAGCTTGACGTTACTGTGGGTGTTCTTCCCCCGCCGAGCCT
ATCGTAGTGACCGTGCCATGCTGTGCTGCAAAGTGTGGTGGCAAAGCGAGGATCCACGTGCTCGCTTACTCCCACTCGATGGTGGCAGGCGGCTTGGACG
AGATGTCGTACACGACGCGGTTCACGCCACGCACCTCGTTGATGATGCGGTTCGACATGCGGCCGAGCACCTCGTACGGCATGTGGTACCAGTCGGCAGT
CATGTAGTCCGACGTGCTGACGGCACGGATGGCAACAACCTTCTCATATGTGCGGCCGTCACCCATGACACCCACAGACTTGACCGGCAGCAGGACGCAG
AAAGCCTGGCCCGTGGTCTTGTAGTGGCCGctgttgcgcagctcctcgatgaagATCGAGTCGGCGTGGCGCAgagtctccagcgcctcgggCGTGATCT
CGCCGAGCACACGGATGGCGAGGCCGGGACCCGGGAATGGGTGGCGCCACACGCTGGGCTCGTCAATGCCGAGAGCCATTCCGAGCTCACGGACCTCGTC
CTTGAACAGCTCACGGAGCGGCTCAATGAGCTTCAGGTGCATCTTCTCCGGGAGGCCACCGACGTTGTGGTGGGTCTTGATCGTGGCCGAGGGGCCCTTG
TACGAGACGCTCTCAATCACATCCGGGTACAGCgtgccctgcagcaggaagtccaCCGGGTGGCCGATACGGTCGGCCTCCTCTTGGAAGAGGTCAATGA
ACAGGTTGCCGATCGTCTTCCGCTTGGTCTCGGGCTCGGTGACACCCTTCAGGGCAGCCAGGAAGCGGTCCGAGGCGTTAATGCACTTGAGGTTGATGCC
CAGCTTGGTCTGCAGGCGCTCGACGacctccaccgcctcgtcctTGCGAAGAAGGCCGTTGTCGATGAGCACAGCGTGGAAGCGgtcgcccagcgcgcgc
tgcagcagcaccgcagcGACGGACGagtcgacgccgccgctgacgGCGCCGATGACGTGGCCCTCGGGGCCGACGGTCTCGCGCACCTCCTCGATGAAGG
cgtcggcgatgctgcgcaTGTCCCAGTCCGTGGGCGAGTTACAGATGCTGACCACGAAGTTGCGCAGGATGTCCTTGCCGAGGGGGCTGTGGGTCACCTC
GGGGTGGAACTGGATGCCGTAGAACTTGCGCGCcacgtcgacgatggcggcgtgCTCCGAGTTCTCCGTGGTGGCGATGTCCACGAATCCGTCGGGGTTC
TTGTGCAGTTTGTCGCCGTGGCTCATCCACATCTGGAACTCGTCCGGGAGGCCGTCGAACAGGCCGCCGCAGTCCACGCCGCTCTTGCGGGCCACAGTGG
CCTTGCCGTACTCGCGGTGCTGCGAGGGGGCCACCTTGCCGTTGTTGGTGAaggccagctcctgcaggcCGTAGCAGATGCCGAGCAcgggcagcttctg
ctcctcgatGAGTTTCCACACCTCCGGGTCCACGTGCGGGGCGCCGTCATCGAAGACGGACTGCGGGCCGCCCGACAGGATGATGCCCGtcagctcgtgc
tggcgcagctcgtcggcgctCACCAGGCACGAGTAGAGCTCGCAGaacacgtgcagctcgcgcacgcgGCGCGCAATCAGGTGGCTGTACTGCGAGCCGA
AGTCCAGGATGGCCACCTGCTTGCGGTTGGTCACGGGGgaggcgtcggccatggtgAACGGGGTGTCGGAGCAGTCTTCGGCGCGTTCGGTTCTGACCAG
CGAGCGGCTCCCAGCCGCCACCATTTGACGTACCtcagccagccagccactCGCCGCCAATCAGCGGCCAGAGCGTGAccagatggctacatgtagccat
cctgTCCGCCAATCACAGCGCTCCATCCGAAACGACGCGCACATCAGCCGAGGACGAACTGCAAGTACTGGCAGTTGCCTGGCGCAGGgcggccacgccc
agcggCGACACGCGCgggttctgcagcagcacgagcgtctccaaGCGACTGGACGCCAGTGCCGGAGCCACGTagcccagcacgccgcgGTCCGACAGGA
AGTTGCGgctcagcgccagcacgcgcagctgaCTGCCAGCCAGAAGAGCTCGCGCTAGCGCGGGGCAGGCGGCGTCCGCGACGTGGTTCCCGCTGAGGTC
GAGCTTCCACAGCGCTCGGTTGTAcgtcagcgcctcgaagATCGCGGCGGCTCCGGCGCTGCCCACTTGGCAACGCTCGAgaaccagctgctgcaggcag
CTTGGGCTCTGCGCCAGAGCGCAGGCGAGGGACACGACGGATGCCGGGGCGAGCGGGacgttggccagcacgacggACACGAGCGTgaggctggagctgc
gacgactgcgctGCAATATGGCGGACAGGAGAGACGCGTGAGAAGCTCGGAGCGGCGCGTTGCACAGGATCAGGGACTGCACGGGGCACGAGCTGCtact
ggagctggagcacacGTCCAGAGCGTCTACGACCTGCTCGTTGAGGTTGAGAATTGAGGTTGTGTTGCCGGTGCTGTGGAGACCACCGCTACCGTCGACT
ATGATGCTGGTGGATAGGGAAAGGAGTTGTCGGAGCTGGGGGCCTTTGAACACAGTGCCGCCACTGCCAAGGAAACGGTGCGCAATGGGGTGAGTGGCTT
GGGAGCGTGGCAGCTCGTAACGTTGTTAGCAGAGCATTCACCTGTACGAGAGCTGGCATATCCCGGTTTGGCGCACACGAttgagcagcgtgaagaaAAG
CATTGACGGTATCTCGGCGCGCTGAGCACAAGATGGCTGCGGGGTTAGTGACGCGTCCTTCGCATGGATACGATGGATGCAGTAGCGtacctcctccagc
gtgagTGGTTTGCCGAACTTGCCTCCAGAAGCGGTGCCAGGCTTACGCTGGCCGCTGATGGGGGTGGCTTCTCTTGAACCGATCAGCGCTGAGCTGCGCA
CACGCAACACACTCTTTTCAAGCAGGGCCGCGGCCTCCCATTGACGGAAGCAGCGCTCCAATGGCTTTTGTGACGCTGCCGCCAACAGTCTTGCCTGTGC
TGCCTTTTTGGCCATGACGGAACGTGCCTGCCGCTGTGCTCGGTGGCGGCGGAACGTTCGCTGTACCAGACAAGctgcctcgtgctgctctcgccGCGTT
GCTCGAGTTGCCTCTCGCCAGCCGCAAAACAACCGGCGCACTCTTTGGAACGCTAATTTCCTCGCTGCTTTCTGACCACGTTGAGCAGCAACTGAATGTC
TATCGAGAGTGCTGAGGTACCTTCGGCGCATTAGCCAGCACCGTAGTCGACGCTGGATTttggctgccgctgcgtgTTGGCGGGCCTTGTTGGCGTTGCA
TTCTGCCCAAAGTGCTCGGAAAAAGCTTCGTGCAAGGATGTGGAAACTCTGCTGCAGTTTCCCCAGCAGTCGGCGTTGTGCTGCCCGCTTACCGAGTACT
CGGAGAGTTCGAGAGCGCTTTTGTCGCTGTCTCCACCATCGCTGCAACTGAACCACGGAAGTATCGCGTTGTGAAATGTAGCGTGATAGAGCGAGCAGAC
ACGCCCAGAGCTTGATGTCCGGGGGCTGGTCTTTCAGCCCGCTGCCGAATGTTACAGTGCCATTGACCAGCATTTCTGCCTGATGTCGTCGATGCAGCCT
TTGACGAGTGCAAACTCCTCGAAAGAGCCCCTGGATACGGACGACAGCTCCGTTTCTCCTTCTGTGGTATgcctggacgtgctggcgaagaagctcgaaT
CCTGTTTGCAGAAACTGAGATTCACGCGATCGCGTGAGCTTTACAAGCACATTgagagctcgtcgacgacgggCACGAAATCGTTTTGCTTGTCGCCGGG
CGAGGACACCTCTAGCGTGCTTCTGGATGGTAACAGCTGCACCTCGCTTGCGGAGGCGACGGACGAGCGCATGGGTTGCAAGTGCCCGCCAGGGACTCAA
AAGCATTTGATGTCTACGATCCGAGAGCAAGCGGTTCAttgttgcagttgcagctcgGTGGCGTCGTAACTCGACATGGTACTGGCGCACTGCTAACCGG
GAGCGGTATCCACGTTGAATGATCCGTGAAGCCCAGTCACGCTCGTTTCGAGCCTCAACAAGTTCTGAATGCCACGCTTGAAACACGCGTGAGATCAGCG
ACATTGAGCGTCGGGCAAGACACTGCTGCAGAATACCATTTTGCTGATGACGCAATAGAAGCAGCTGAAAGCAGAGTTTACGACTGCGCCAGGCTCGGAA
CTGTCGCTGAATgcgcacagcagcttcaacgcgcTCTTGCTTTAGAGCTGACGCAAAGCTGTGCCACCTCCGGAAGACtccaagctggccaagctcgGCG
CAACGACCAGCAAACCTCGCCAAAAGAGCCTCGCGTTCCACTCTCCGTGCTCGAAGAGATCGCAGTGTGCGTTTATCTCGCGCGATATGAAGCAACGATT
GAATTTTCCTGGCAGCGGCATTCATCCTCAGTTCGATCAGCCGGTCGTCTTGTTCACCCATGGCTGTGTTAGCTAAGGCTTCCTTCACTCGCTGCTTTTC
GCGTAAGAATGCAAGTTCCCTCCGTGATGTAAACCACCTCCACGCGCATTGGATCCGCAATGCCATCgcatggcggcgctgctccaggaCATGTGCGACA
CCGAGGCGCCACTTTGCCaaccgccaccgccgccgaagTAAAGCTTGCAAacgtgctgcgcttctgTGCTCCAAGGCAAAATgttctcgccacgaagcaC
TGCATATCTCGAGCAAGAAGCGTTCATGGCGGGCACTGTAGTATTCATCACGGGGCAGCTGCAAAAGAGCTTCAGCGAATGCCCTCTCTGCTCCAGGGTC
GTCTCCGGTACGCAGTAGGCTAACGCCCTCCAGAAGAAGTTTGGCAGCAGGTAGTGCTGGCTTCGTCCTGCGGCGCGcttcacgaagagcagcaagaact
AGAAGCGGTGCATTAGCTGGGCCTGCGAGTCGCTGGGCTAGATCCAGCCACGTCTGCACGTCACGACACCATAGTAGCGTGCGTTGTTCCTCGTTCTTCC
GCGATGTCGTGAACAACGTGTGTGCAGTCTTCTCAGATGGTAACACTGGTGGAAGTGCAACCAGAGCTTTGTACGCTTGGGTGTACGTCTCACGTTCTAG
TGGACGCATACCGGGCACATGTGAGAGCTCCAAGGCTGCTAGCAGACTGAACTGGTACGCGGCGAGGCGATACGGGAAAGACGATGCGGGTCCCTGCCCC
TCAGCTAGGTACTGAAAGTACTGTGCACTCTCACGATGACGACCCAAAGCTGACGCTGTAAGCGCCGATAAGAAGATGGCCTCATTAAGTCGTGTAGACG
TCGGATACCCTTCCACCAGCAACGTGCACACGGCCAGCGCACCCTTGTACGATCCGAAGTCGACATAAAGCCTCACCagcggaagcagcagttCTGGACT
CGATTTGCTGTTTGGATACTCCATCGCAATGAGAAAGGTGCTGTAGGCCTCTTGGAGAAGCACCGCGTGCAAAGGTTTGGCACCAGCACTGGAGCCTTGC
GGTCGTTTTGATTGTGTTGTTGATGAAAGCTCGAGAATGGAAGGCATGTGCAGCGTCCTGACGTGGGCCTCCCATAGCTGGAATTGTGTGAGTGCAAGCT
CAGTCCAAAGCTTCTCCGAGTCACCATCGCGCTGCCATGTGACGTGGTTAGTGCGATATACGCTGATAAAAAGGTTAAAACCACTTGTGCGTACCTCGAT
GATGCGCTCCAGTGCATCTGCGGCATCCTGGTACATACCACGATGCCGGTCCCGGAGTGCTTGAGCATAGGCTGTCTTGGACTCTTCGCTCGAGAACGAC
AAGTCAGCTTCATATTTACAAGCTGGTGTCGTTGTGTGTATATGATTCATCGCTCGCATGGTATTTCCGCCTTCTCTATATCATCTCTTGTTTTGCCATG
AACGAGTCGCTTGTAGAAGTTATGGTTCCCTATTATCCGCAAAAATAACCTAACAGCACCCACGATTAGCTCCAAGAGAATCGACGTCCTGATCCGTGGT
GCTTGTAGGCGTCATCCAGACGTTATCGAGTTCGCACACAATGCGGATGCTCTTGCTGCGTATTTCAAGTACTTCTGGCCCTCGAACATGCGCTTTAACA
AGTTTCGCCATTTCCTGAAACGGAATCATCGCTTCAGCGCGCAGAGCAGATGTCCCTCGTGGTAGCTTCTTGCTTTGATCATCGAACTCTaactgctgct
ccgtcttGTTTGCTTCACGCTGTAGCGAGCAAAATATGCTACGACATGGTCGGTCCTTGGCGTGCTCCGCATGTGGGGGTTGCATAAATTCCTGAAATCG
TTCTACCCACGAGGCTACAAAAAGCGGATCACTGATGAAATCTCTCGTGCCAGAATGGCCAATGTagtgctgcacgagctctgCAAGCTTGGAGAAATGG
AGCTCAAGACTCAAATCTTTCGTGCTCCTGGTGAAAACAAGCAGGCTTTTCCAGCCCGCGTCCGCCCAGCGCAGTGGGCTAAATAGCGCACCCAAAGCCT
TCAGACACGGTTCTTGTAGCGTCGATGTTATCGAGACGGACCCCTTCACCACGTCTCCAAGCGATCCTACACCAGCAAAGTGCGTAAGTTTTCAGGGTAC
CAACAAAGCGCCTGCAATTACCATAGCCTGGGACAGTGTTCCATACCAATTCCAAGCTGACAAAGCATCTCGAGTAGTTTCGTGGCTGGGTAGTTTTCGT
ACGTAGCCATGAACTTTTCAGAGGATATTGTCGAAGCCCCACCGAACAACTCAGCTAGTGCTGCTTCCAGTAGAGCTTCCTTTCCGAGCGCCTGCTGGAA
AGCATTAAACTCCTGCAGGCTCCATTCACCGCTGTGGTCGGTGTCAAAAGCATTAAAAACCATCCTCATCGCGCATTCTCGATTTTGTCGTTTTCCAAGA
CTTTGCAGCAGGGCTGCCATGTCCTGCGAAGATTTCACAATGTCCGACAACGACTGGTCCAGCTCACCCAACACGAAAAGGCTTCGAATCCCAGCTGCAA
ACGATGTACCGGTGCACTCCTGCATAGCGGAAGGCAGTTCAGAATCATTGTGAAATCGAGAAATAAACAGTCGTTGAACAAGATAGCTTACCTCCACATT
TGAGACAAAGTCTTCACGGAAGTCAATGCAGACGCGAAGATACTTGCCAAGTACAGGCTGGACCCCTTCATCACTACGAATATCTGAATGCATGGTAGCT
GCGGCAATGGCAGAATATGCTGGTCAGTTTAGATATAGCACAACCCGACCGCCAGTTGCTGTGCTGTCTTTTGAGTGAACCTGAGCACTTGGTCCATAGA
GATGCAAACGATGACCAAACGTGATTTTGCTGTACTGCCTTCTCTaccgaagaagccaagtcGATGCCTTCCTCATCTACATTCAACAAAGCGGAGCATC
GAGTCAGACATGATGCAGAGTGAAGTAAGACAATATTTCAAAGTAGCTCTCACCTGTTATCTCCGGATTCAACAAGAAATTCATGATAAGGCGCATCGTT
TCAATGTCCGGATCCTCTGGCTGGCTGTCATCACTGTCGTAGTCGACCTGCTCTTCCTTACTAAGCTTGGTCTTGTGGCTTTTGACTTCCACATCACTAT
TCGGTGGATGAATCCCCAGTCGGAACCTGATGTTATTTCTTAGAGAAGCACCGACGTGTTTGGATGCTGGAGAACTTGTCGGTGCTTGCACTGGCAACAC
ATGCTCGCCAACTTGAACGTTGAGGCTCCACTGGAGTTCGCCGTCGTCAGTATCAGGCCTTTGCGTGGTATTCTGTAAGCtctcaagaagacgctccTTA
GCTGCAGTTGTCCGCCGATGGGCAGTTGGCCCCAGCGCCTTCATTCCTCTTTTGACGaaagcagcaagcgcagcctTCATTTGTTTCTCCATGCATTTAA
CGCCCGCGACGACAACATTGCTCACAATCTCCCAGAGCGCCTCTGGTTTCTCGCGTCGTCGATTTTGCGCCCATGCTTTCATGACGCGAAGGATGTCACC
ACATCGTACAAGTCCAAACTGGTCGACTGCCATCTCTCTCACAAGCAATGCAGCCTACAGACGCCCAAGCAACACAGGGATAACTACTTACCCATTAAAC
CGCGGGACATTTCACTATACAAACTAACCTCATCCCGTGACAGCGATAGACCGCCGTCCGATACAACCTCGACCAACCGCTGCAAGGTTCGTGCATCAAC
ATACTTTTTGACCTCAATGGCAGATAACACGCGCATCGACTGATCGGATCCCTTTGGTGGGGGCGGGCACACCACACTCTGGAGTTTGCGAGCAAAGCTT
TCTGCAGTGGGGGCCGAGGGGACCGCTAATGCTCGCTGCCCATCGGTGGTTTTGCTTGGTCCATTAGCAGGAGCAACTGTAGTTGCTGTTCTCCCTTTAT
CCTCTGGCATAAGCAATGAAGAAATTGAATTTCAAATCTAGCATAACTGAGCAGAGTCATCATCTAAGCTCGACAAAGCCACAATACCTGACGTTGTTAC
CCGCGCAGCCTGGTAGTCGAGGTAGGCTATATGTCGCATTAGCTTCCCCTGTTGTATTAGCAGTTCAtccgacgacgtcgctgcacTCTTCATACACGCA
ACAAAAGCATCATGAAACTGAAATACACTCTACGGGCAATGCCTGCAGATATCAAGCACGCACCGCCTCAAGATCGCTCATGAAAAATAAAATCTCAGGG
TCTGCGAGAGCTTTGTTGACGACGGTTTGCCGCAATACCTCGTCACTGTCGCCGAAGAGACCTGCAGCACGGTACCCACACTTCATTAAGCTGCACATAG
CAATGGCCAATTGCATCCATCCGTACGTCGAATGAGCGGTCTCATCGTGGACTCTTGCAGCACGTCGGCTCCAGGAGCGAACATCTTCAAACCCCTGGCC
GCGGCCGATAGCACCATCGTGAGCTCGCACTTGTTGAGCGTCTTCAGTCCTCCGTTATCTAGTAGCGACAAGACAACTGGCCCCCCAGCAGTTAGCCTCC
CCTGCCTCCTCCGTCCTTCAGCACGTCTGCTGCGTGGCCTCACACTCGAGTTTCTggggcttcttggcgtccacgagGAGCGCCAGCCCACTGAAGAAGT
CCATGACTGCCAGCTTCCGCGCGCCTTTCAggtccagcgtctcgaacatggccagcagctgcagcttgtccttgtcgGGACAAAGCGGCACCACGATGGT
CTGGAACACGGGGAACAGCAGGAAGTACTGGAACACGGGGTCCGCCCGGCGGCGGTGCGCctcctgctggaagcgcacatgcagctgctccagatccgcc
cacgagcgcggcaccagcggccgcagcttccagcgcacgccgccgccctccgCTCCCTTCGACTGGCTCGCGCCCATACTGGGAAATGgcttcacttcaa
catcgctCGGATTGGATGCAAAATGTTTTTATTTGGACCAATGACATGGCGCGTTGAATTGCAATGGATTTTCCACAGTCACACCGCGCAAAACGTAGCC
ACAGTCGAAGAGTTGGAAGGCGCGATGGAGAACAAGTTCATCCCGCAGGCGATCGAGATCGTGACGCAGGCCATCAATGAGGACAACAGCAAGAACTACC
AGGAGGCCTTCCGCCTGTacaagaaggcgctcgagcacttcaTGGTCGGCGTGAAATGTGCGTTTGAAGTTGCGCCCGTCGACCCCGCGGGGCTTTGGAC
TGACGTGACCCCCTGCCCTGCTGTGTGTGTGCCATGTGCCAGACGAGAAGAACTCGACGTCCAAGGAGATCAtcatgaagcgcgtggaggGCTACATGAC
GCGCGCGGAGCAGCTGCGCGggatgctggagaaggagaacgcgcCCAAGGCCGTGGCAGCGGCTGTGGACATGGACAAGTGAGCGTGCGCTGGGGTCTGG
TCACGGGTTAGGAGGGTCTCTGGTACTGACATTGCTGTGCACAGAGgcggcaaggaggaggacgacgagaccgACGCGGAGACAGCCAAACTGCGCGGCT
CGCTGGCCTGTACGTTGCTCCAATGACCAGATGACGGGGTTAACTTTGTTATTGACGGggcgttggctgctgctgcacagcGGCGGTCGTGACTGAGAAG
CCTAATGTGAAGTGGGACGATGTTGCCGGACTGGATGCTGCGAAAgaggcgctgaaggaggcAGTTATCTTGCCCGCGCGGTTCCCGCAGTTGTTCACGG
GGAAGCGGCGCCCCTGGAAGGGAATTCTGCTATACGGGGTAGGATCTAGCGTGATGATTTGTGAGCATTGTTGCAGTGAAGTGGCTTAccttcttgctgt
tgatTTTGTTACGTAGCCTCCAGGTACGGGTAAATCCTACCTCGCCCAGGCCGTTGCAACGGAAGCAGATGCCACGTTCTTCGCCGTCTCGTCCTCTAGT
TTGGTGTCAAAGTGGCAAGGCGAAAGCGAAAAGTACGATATTCGTACTGggatgctgcagctcgaattgaagttctcgtcgctgacTCTCTCGTGTGTAC
CCTTGTAGATTGGTCAAGAACCTCTTCGAGATGGCGCGTGAGAAGAAGCCTGCCATCATTTTCATAGATGAAATCGACTCGCTATGCTCGAATAGATCCG
AGGGTGAAAGCGACTCGACGCGCCGCATCAAGAACGAATTTCTTGTTCAGATGCAAGGCATGGGCAACAACCATGATGGCGTTCTGGTACTTGGAGCTAC
GAACGTACCATGGGAGCTGGATCCAGCAATGCGGCGACGGTAAACGTCTCATTATTTTTGCGAGGGGGGGGCTGTTGATAGCTGACGTAGTATTGTCACC
TTGCAGATTCGAAAAACGTATTTACATTCCTCTCCCTGACATCGATGCACGGAAGGTGATGCTGGGAATTCACCTGGGCGATACGCCGAACGAACTGAGT
GATGCAAACTTCACAGCGATCGCAGATAAAACAGATGGGTACGGTAGCACTTTTGCAAAGCTTGATGGCGGAGGTTGAGTCTCTCAAGTTGACGCTCGTT
CTTGCCGTTGCCTTAGCTGCTCTGGTTCAGATATCTCGGTACTTGTCCGAGACGCGCTGATGGAACCACTTCGAAAGTGCCAGCAAGCTCAATTTTTTAC
TCCGGTACGAATGCTAGTCAATCATCGCAGCTTGAAGTGTATACTGGGTTTTGACACGAGGTTTGTTTTATTGCTTTTCAGTGCAATGATAAGGCGCACC
CTGTTCGGAATGGCCCATTCTTGACACCTTGCGAAGATGACCCACCATGTGCGTATTGCCACATGAAGCTCTCTTCATGCCACCTGAAGTGCCCGGACTG
CAAAGCCCCGTGCCGACGTTGCGGAGCGCTACGCATGCGGCTGTACGATCTGCCGGAGCGTGGCTACTCTGATGAAAAGCTGCGGCCGCCGATGATCTCG
ATGGTAAGACCACCTACTCCTTCACTAAGCTCTGGTCTTGCCTCGCTGACCGGCTAACTTTGTTTTCGCTACAGAGTGACTTCACGCGCGTGTTGGAGCA
TTCGTCAGCAACTGTCGCCTCTGACGAGCTCAGCCGTTTCGTGAAGTGGACGCAGGAGTTCGGACAAGAAGGCTAGACGAACGCATAGACAGATGACTCC
GTCATATTCATCTTTCTAAGACCGTGTCGATATACTTACTGCTTCGTTGCTTGCTTATTTCTGAGTGTCGGACAGCGAGTCGATCAGaccgtccagctcg
tcggaAGAAAAGCGGTGTGCATCATTACAGAAGTGACAGGTGAGCTCCACGCCAGCGCTGCCCACGTCCGCTGCAATTTGCTTCAAATCAGTTGCCCCCA
TTTCCTTGAGCCGTTGCACGTAGTTGTCCttggagcagcggcagtaGTAATCCAGCGGCACTCGCTTGCAGTTCGTTTCCGTGATATCAGCACCCGGGAT
CAATTCGTTCAGATAATCCAGCAGGTccgtgttcttcttcaattCGGTAGCAAGGAACGGGAGCTTGTCGAACGCCAGCTCGTCTAGCTCGTAGTGCCGT
TCGTGCGCCTCCGTGGGGGGCATCTTCTGAACAATGAGACCACAACTGCGCGTATGCTCTTCGTCGGCCTCGCTGTCGATGCGCACGATGGTCGGGACCT
GCTCCGACACGTCGAAAAACCGCTGCCAGTCCAGCTCCGGCACTCCGGATGCCTCAATGGACGTGTTGTACGGCATTGCTGCGCCGTACAGAATTTTGGA
GACGTGCATGTGTCCTCCACGTTCCGGCGCCCCAGCAAGCGACTGATCCACGTAGACGGCTTTGCCTCGGACCTGGACGGCAAAACCACATGGGTGAGCT
CGCTTTGCTCGCGTGCACGCCGATACTACAAGATCCTGCCCGCACCTCCCCGACGGCCATCGATTCAACGTAAAGCTCCTGGATGTTGGGCGTCTTGACC
ATCATCTTGACGCGCTCTTCGCCCTTGAAAAAGGAGCTGAGCATGGCCGTGCCGGCCATGTACTCGCCCCAGAGCTTCGTGCCTTCGGAGGCGAGCGGCa
gtcgccaccgccgcgccacctcctccaccgcgCTGCGCGCCATCACCCCGGACACGCGCAGGTTGCCCACATGGCAgcgcaccaccacgtcgcgcagcgg
CCGCTTCCACATCGCCGCAAGTTGTCTACTGCCACCCGCTAATCAGTCGGAACTATGGTACAGTGTACCAGGTTCCTAGCACCTATAGTCATCAGCAAGT
TGCCTTTTTccgctgcaggacgagctggcgcgcgagGTCCTGACAGCGCACGCGatccttctcctgcagctgcagcaccttgcacTGCTTCCGGTAGCCC
GAGGAGCCGCTTTCTCCAGCAAGGTTCAGCTTTCTGGACGACTGCTCGCGATCGACGGCGGTCGGGAACAGCGAGGCCCCGCCGACCTTCCCACCACCGC
CTGCATCTCCAGTGGAGGGAGGACCTTGCGCTCTCGCCACCTTTTCACACGCACGAATTTGCTCCCACATGTTTGACAGCGCCACAGCGTCACTGAAGCT
GCCCCCTTCAGTGTGCGTGTCGCCCCGGAGAGGCACGTGGGCTGTGGTCTTGCACCCGCGCATCGAAATctcgtcggcgctgaagatccgcgcgctgcag
caggagtaCTTGGCAGCCGGGCCGTGATCGACGATAGAGCCGGGGTGATATGCGCACTCTCGTAGCTCCAGCAAGCTGCACCGTTGcttgcagacgctgc
agtcgaagtACTTGGTGGAGCCCCAGACGTACCAGTATGCCGCGCTCCACGAAATGCCCTTGTGTGCGCCAAGCTCCTTCAGAAATGCCTCGACCTGCCA
CCCTGTTTTTGCTTGGTGCGTCCCGACCAACTCCCCATGCACTCCGATCTGACGCTTCCCTTTCTGGCAGCCTAGCCCACCCCTATCGCCCCTaacgaac
agcagctcgcagtTCGTGCATATCTCTAGTCGACGCTCACCTTCCTGCAGGGTTTTCACCAGCGCTTCGACTTTTTTCCGCCGCAGCTTGGACAGGATCT
TGTCCTTGGGGtcgtgcagcgtctgcagctgctcgggCGTGCAGTTGGCCGCGATcttggcgatggtggcgtcCGACAGGCAGCCGAagtccacgcgcag
cagcatgaagTCCTGCACACGTCCCGAGATGAAGACCACGCactcctccacgagctcctccatctgcagGAACTCGGACGACACGAGGATGGACGCAATG
TTCTCGAGCGTGATGCGCGAGCGCCACTCGTGCTCGCGCCGGTGCATGCACtccatgagcagctcgaagatcTCGACGTCGCAATGCACCGAgatgtcga
tctcgtcgtgctcgttGGCTTCGTTCAGGTACGCCTGGAAGTacttcatcttggccagcagcaggtcgcgctGGCACGCGAACTCCTTGCTGGTCTTGCG
GAACTCGTCGAACACGTGGATCACCACGCTGcgtgatgacgacgacgacgacgcgtccaccACGGCCGAGGCGGACAGCAGCCTGCCGCTCGACTTCATC
GCTCCGACCACGCACTTGCGCCGCTTGGCGAAATGGCTACAGCTTGAAGTATCATCTCTCCGCCGCTGTGAAATGCTAGCGTCAAATTCGGAGGATATGA
CCcggcgcaagctgcagtcaTTTCGATCCATGGGAAAGTCCTGCGAGGTTTTTTTCAGACGGTAAAACCTAGTCCGTGTTCTTCGCGGTGTGGTCCACAC
GTATCTTTTTTATTGGCGGCCGCCGAAGGGGATTTTTACAAGGAAAGAAGCCGCCGAGCTCCAGCCGCCAGCGTCCCGGCCCCGAGAGAGAAAGCagacc
cgcagcagcaagcatGTCGTTCCCCGCAGGAAAAGCGCCGGAGCGCAAGAACCTGTTCAAGAAGGgcatcgactcggacgagtcgcgccgcagccgcaTG
GAGACGACGGTGCAGATCCGCAAGACCATCAAGGAGGATCGCATgaaccagcgccgccgcatGGTACGGAGATAGACGGTAGCAATAGAGAAGCAGGTCC
AGACAGGTGCCTTCTGGCTGGGAAACAGCCTCCTCCCTGGGAACGGCGTTGGCTGCGAGTCTAGAGTCGCATCGTATCTTCCAGTTACGGTGCAGAGGGA
GAGAGGGACGGATGACTCACTTTATGTTGCTATTGTTGATGTAGACCCCAGGGGACAACGGAAGTGCAGCCACGCACGCGATGGGCGATGCCGCCGGCGa
gttgacgctgctgcagcgggtaCGCAGACGTTTAGCTGGATACGCGGATACTCGGTGGGAGGTTGCGAACTGACCTTtgtgtgctggtgctggtgtaGCT
GTCGGAGCTCCCGCAGATGGTCACGGGCGTGCAGtcgagcgacgccgccgtgcagctcgaggcggtGACCAAGTTCCGCAAACTGCTGTCTATTGGTGAG
CCTCGCATGCTGACTGTGCTTGTGAATGAGACAAGGCTAACTTGTTGCAACTGTCTACGGTGCGTGACAGAGCGCAACCCGCCAATTAAGGAGGTGATCG
ACACCGGCGTCGTCCCCATTTTCGTGCAGTTCCTCCAGCGCGAGGATTTCCCCACGCTGCAGTTCGAGGCCGCCTGGGCTCTGACGAACATTGCGTCGGG
TACCTCTGCGGATACCGAGGTGGTGATCAATCACGGCGCTGTGCCTATTTtctgccagctcctgctgtcCACGAACGACGATGTGCGCGAGCAGGCTGTG
TGGGCCCTTGGTAACATTGCCGGTGACTCCATCGAGTGCCGCGACATGGTTCTGCGTTGCGGTGCCCTGCGCCcgctcatgcagcagctgacggAAAACT
CCAAGCCGACGATGCTTCGTAACGCTACGTGGACACTATCCAACTTCTGCCGTGgcaagccgcagccgcagttCGAGCTTGTGGCGCCCGCCCTCCCGAC
TCTCGGCCAGCTCATCTACACccacgacgaggaagtgCTAACGGATGCGTGCTGGGCTCTGTCGTACCTGTCGGACGGCTCGAACGAAAAGATTCAGGCG
GTGATTGAGGCTGGCGTGTGCCGGCGAattgtggagctgctgatgcACCACTCCCCTTCCGTGCAGACGCCTGCTCTGCGTACTGTCGGCAACATCGTAA
CGGGTGACGATCTGCAGACGCAGGTCATTATCAACCTGAGCGCGCTGCCGTGCCTGCGTGCGCTTCTGGAGAGCCCCAAGAAGGGAATCCGAAAGGAGGC
GTGCTGGACGCTTTCCAACATCACGGCCGGCAACCAGGAGCAGATCCAGTTCATCATTGAAGCCGACATTTTCCCGTCCCTgatcagcttcttgtcgacg
GCCGAGTTTGACATTCGCAAGGAGGCCGCGTGGGCTGTGTCGAACGCCACGTCCGGCGGGTCGGCGGAGCAGATCATGCACCTTGTCAACCTTGGTGAGT
GCAACAGCGTCGATGGCCATATTTGTTTTTCTTCATATTTGCTAACGTAGTCATTTTTTGTGGCTGGTTGCAG