Description :
From Genome Similarity Track
Location :
Scaffold_4:417798- 418894
Transcript NameFunction/comments
Phyin_T30-4PITG_03083Nuclease
Phyin_T30-4PITG_03084Nuclease C1

Sequence
1096 bases(100 bases per row)
TCACCCTACAGACGGCAACAATGATGTGCAAGTACTGACCCTGTGTCGCTTGAGACCACCGACTATTGCACCACACCATATGTACGCAAAGTTTGTGCAT
TTTCCGCCAATCCTGATAAGACTCAGTTTTGCATGAGTGGATCCACCAGGAAGCTTATCAATTGTGCGGCGGAGAGCTATGAAGGGCCGACGCCAGCGCG
CCCAGACGCGATCTGTGTACAGCATGCTACCTGCTAGCATCCGGTATGTTCGCCTAGTCGTCGTAGAATGATAAGAGATGAGTTCTACGCCTGTATATTT
GTTGTGGTATCCGTATTTACGAGTGGACTCATGGTGGACAACCAGGCGGACGCTGGCAGGTGTATCACTTGGCATCTCCATTGGCGTCGCAGGGACTTTG
ATACTGCTAAGAGTTGAAGAGGAAACCGAGAAACCAAGTCGACGCGTCCCAATTCCGACCGATCGCAAGCCATTCGATCCTAAAACGCTACCCAAGCATG
AAGCACTTCGCTACGGAATGCCCTCCGACTCGAATGTGCATGTGCGGTCGGGATACGTCGTGTCGTACGACTATCGGTGCGTGCATTGAGTGCATATGTA
GTGTTTAGTGGATAATCTGACGGGTTTTATGTTTTTGCTCTGTCAGCACGCGTAATGCGTCGTGGGTGATGGAATACTTGACGAAAGACTCGCTGCGAGT
TGAGCAAGAGACGGATCGAGCGAATTCCAAGTTTGTTGTCGATAAAGATGTTCCAGAACAGTTTAGGGTGCACCCGAATCGGTATCTTAAGAGCGGCTAT
GACAAGGGCCACCTCGCTCCAGCTCGTAAGTTCTCCCCCTTATCCCATCAAGAAAAGTTTTAATCCCTGCTCATTCCTTATGCCGTTGATGGAATGCAGG
TAACATGAGTCACTCCCAGGAAGCCATGGACGATAGCTTTCTAATGACCAACATGTCGCCGCAAGTCGGTGTTGGCTTCAACCGTGGCTATTGGTCACGT
CTTGAGGGCTTCATGCGTCATCTAGCTGGACAATACGACGCACTTTACGTCATCACAGGGCCACTTTTTCTTCCTAAGGTAGATAAGTACTTTACG