Description :
From Genome Similarity Track
Location :
contig_100:41778- 43205
Transcript NameFunction/comments
g13491.t1hypothetical protein

Sequence
1427 bases(100 bases per row)
CCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGACCTGCACGACGGACGCATCGAGCAGATCTGCATCC
TCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGGACCAGCTCATCTCTGAGGGCACGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTT
CGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCG
CAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTATTGCGTCACGCGACAGTGGCCATTGCCGCGTGAGCAAGTCAAGGCGATCA
ACGACTTATTTGAAAATCGTCGCAAGGCAAGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTCAAGAAGACACAGGGCAGGTG
GCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAAATGTGATCATCGATTCGATGACCTCGAGT
ACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGC
TCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCGACTTCGCACCGAGCTATTT
CGATGATGTGTTCATTCACAGCCGGGCTGTGAATGGGAGATCGGATGTAGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGTAC
AACCTCTACGCAAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTTGGGAAGAACGGCGTACGCCCTGACCCAGGAA
AGATCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAACTGTGGCAGTTCCTTGGACTCGCCACGAACTTGTGCAAGTACGTGAGCAACTA
CGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTGAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGGC
TTGACTGAGGCGCCAATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAAC
TCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCAT
GAAGTATGCACTCGCAAAGTTTCGAGT