Description :
From Genome Similarity Track
Location :
Scaffold_1:4177086- 4180814
Transcript NameFunction/comments
Physo_285786Sec61 alpha 1 subunit putative
Physo_323107Hypothetical protein

Sequence
3728 bases(100 bases per row)
CGGTAGAAGGCCTCCTTGAGCGCGCGTAGCTTGTCCGAGCGGGTAATCAGCAGGTGGAACAGAGCGATGATGGCGCCCTCGAACTCCGTGCCGCGGCCAG
TGTTGATGGTCGTGGGGGAGAAGGCCTTCCACACAATGTTCTCGCAGATGTTGGTGGCGATGAAGAGCGAGATGCCCGAGCCGAGGCCGTAGCCCTTCTG
CAACATCTCATCCAGGATGATCACGAGCACGCCGGCGCACAGCAGCTGCACGATGATCAGGATGGCGTTGAAGGCGCCGATGTCCGAGATGTTGCCGTAC
ATGCCCGAGACCACGTAGGCCACGGCCTCGCCGAGCGTGATGAGGATGCCGAAGAGCTTCTGCGCGCCGCTGAACAGCGCGCGGTCCTCCTTGAGCGACT
GGTCCACCTCGATCATCTTGGAGCCGGCCAGCAGCTGCATGACGAGGCCCGAGGTCACGATGGGGCTGATGCCCAGCTCCATGAGCGTGCCGCGGTTGGA
GGCCAGGATCACGCGCATCCAGTAGAGCGGGTCGGACGACTTGGACGTCTGGATGCCGTAGAGCGGGATCTGGCAGCACACGAGGAAGATGAAGAGCGTG
ATGATCGTCCACAGCACTTTCTCGCGGAACGGGATCTTGCGGTCGGGCTGCGCCACCTCGGGCAGCACGCACATGACGGGCCGGATCAGGTGCAGGAAGC
GCATCGTGATCCTCCTCTTCGCCTACAAGGAAGCAGTGTCTCTCTTGATACTCTTTGGGGAATGAGCCCTGGGCACGCGGGATCTTGTCTTTTTGAGGGG
GGCTGGCAGCGAGCGACACGTATGTCTCCGCCGTACCGTCGGCGACCGCAGTTTGATGCCAATGAAACCTTATACACTATCTTCAAGCATATTCCCTTAG
GTGAAAAGTGGCTTAATTTCTTCCTGTGAGATTAGCAATACCTGTTTTCGGGAGTTGGAGGTACTTGCTCGAGTTGGTGAGAGCTCTACAGTGCCTGTAA
AAAGGCAGTAAAAAGACGTAATTACAGAATCACGCTGAAAATGCATATCCGGGCATAGCCGGGATGGCGGTCGTGATTGAAACCTGGCAGAATGCACCTT
GCACCGCGTGTCGCTTCGTGCGCAATCGACGACAAGGCTGTCGACTTGCTCGCGCTGGTTGTCGGGCGCCTCGTGCGATCGCGCAGCCAGCGGAAGCCAA
GCCGGTGCAGAGGTTGCAGTGCGCGAACGAAAGCTAAAAGTCGGCGTCGAACGAGTCGTCGTCTTCCTCGACTGCCGCCTTCTTCTTCTGCGCTGAGTTG
CCCATGGTGGACGCCTTGGCGGCTTGGTACGAGCCTCTGCCCATGCTTGACGATGCAGACGCGAAGGCCGACTTGGTGCCGATGAGGTTCTGCAGGTCCA
CCTCCTCCTCCTCCTCGAACTCGGAGTAGTCGTTCATCTTGCCACCGCTCATCAACTGCTCGCAACGATTGACGAGGCCATGAGAGATCAGATCGGCAGC
AAGATACGACCGCAGGTGAGCAGATCAACGCACCTTTTGGGAGAGCTTCATGGGGCCTGCGCTCATCGATGCCAGCACGTCGGAAGATCCGCTTGACCTG
TCCTTGAAGCTGCTGTGTAACATGAGACGGACACGATAGTAAACGTGGTGCACAACCATCTGACAGCGTTGTGTAGCGCGAAACCGACCTTGAAGACGCG
ATCCCGAACACCTTGGGTTTTGGCGGGCTTTGCCGCTGGAGGAAAGCTGTTTGCAGGAGCTGCGGAGTCCCGATTCTGTCTTCGGATTCGGTGGTCTTGG
CCGGCTCTGGACTTGATGAGCGTTGCTCTTGTTTGGGTGGGGAAGGCGACGGAGAAGCTCGCGAGGTTTCTTTCCGTGGGCTCGGGGTCCGGCTGCCGCT
GCCACCCCCACCGCCTCCGCACACGGTCCCTAGGAATTCACGGAGCTACGATGCGCGGTGTCAGTGCAATAGTTTGCGTGTATGCTGCTGCTGATCTTTT
TGAATACCTTTCGCTGGGATCGCTGATTGTCAGGATCGTGAGCCAGGAATGCAGCAACAAACAGATCCACCAGCGCAGCCGATGATATCACCTTCAGCTG
CACGAGCTGCTTCAAATGACCTGACAATGCTTTCCACAGATCTGCACGACAAAAGCATTAGAGATAAGAATTGACGCCTCACCGAGATTCTGGCAGTTTG
TTCCTTACCAAGTTGTTTTTCCTTGTTGCTCTGGTGGAGTTTGCGAATCTTTTGGTCGTTCATGATTCCTTCAAATGCTTTCGGTGGGAAGAGCACTGTA
GATAGCACCATGCGTCAGTGCTTCCCGTTCAGCAGTCACTTTGTTTCGATATGTGCGTACCTGGTCCAAGGTCTCGCGAGATGTCAAGGATTAGCTCGAA
GCAAATATCGGAGCCAAAGAACGCAATCTGCGCTTTCCGTCCTCCCACCGCCATTCTAGTAAATGCACGCACCGATTAATACCAGGCTATCCCTTCAACA
GGCAGTCTCACTTACTTCAGCAGGTCGCGTTTTGACTCGTTTGATGAACCTGTGTCTGTAGATCCGCCCAGCGTATCTCCTTCAGTTGCACCCTCCTCCA
CCCGGCTGATCAGAGCTCCAAGTGCCTTCACACGGTCGACTGGCGACAACTTTTCTGTGATCGATACAGTGATCGTCTGCAATGCCAGCAGAAGATCGTA
AGTTCAGTGTGGATGTATGTTCAAAGCCAACCATACCTCTTCCAATGCTGCCGCCGGAGCTGGGGTTTCCGAAGGACTCGCATGAGCCTCAACAGCATCT
ATGGCGGCCGTGATACTAGCTGTAGTGGGCTTTTCTTCAATATCTGCTGGTATGATTGGTTTCGTGTCTGCAACTTCTTCAATAGGCTTGGTGTCGTTGG
TTTCCGAGAAGTCGAAGTCGTCACTTTGCATACTTGTTAGCAGCATTTCATTTTCGGTCGACTGTGCATTGGCTGGCGTCGAGGCTGCCGGTGAAAACGG
TTCCAACAAATCGGTGGCGTAAGCAATTGACGCTGGTGGAGATTCTGGTAGTTCTGCCGGAACTTCGTCGTTGATGCTTGCTGCTGCTTCCTGAACTGGT
GAGTTTTCAACCGTATCCAGCGTAGGGGTAGTAACCACAGTCGTAATACTTGTATCTCTCGTGTCGGCTATGGCATTGGTGTCATGGAAGGAGTCGATCC
TGCTAGTTTTATCGTCGTTGGGGCCCTCCTCGGTCGCTTGATCTTCCTCGACGTCAACTATTAATGGTGCGCGTGGTGCAACTTCAATAGTTTGCTTGAT
GTCCATTGACTCGGCAACCACGGATTTCGTCTCGAATGGTTTCTCAGAAGGCAGGTCTGTACTGCTTTCAGTCGGTGGCTGGGTTGGGGTGCTCACGTCG
TCTGCATTCAGCACGGTATCACCTTCAACACTTGAAGAAGTTTCATGATTCGCAGCATCGACTTCATCGGAATCTCCACCAGTGGAAAGCTTGCCCAGGG
GCTCCTGTGCCGGCCTATCGACAATCTTTGTAGTGCTTTCAGCAATGTCTGGACTCGTCATAAAAGCCTCCTTAGACTCCAAAATGCTAGTAGCTGCTTG
ATCCCGAGGCACAGGTATGTCGTTGATACCAGGTTCTGGCCCAGCATGACGCTCACCAGGTACTTGAACTTCCACCCGAGACCGAAATGGATCTACGACT
GAGGCAGCAGTGCTGAGAGTAGTAGGTA