Description :
From Genome Similarity Track
Location :
Scaffold_49:417659- 424563
Sequence
6904 bases(100 bases per row)
CCAGGGTTTAACGTGATCTGCAAGAAGAGCACCATCTTACCCGGAAAGGTTCTGTCTATAATCTCGTTTGAGCGCATTGCTCCCAAAATGACACGAATCG
GAGGCGCGCGTGGCTGCAAAGCTAATATATGCTGTTCAGAAGACGGGTCAGTATCAATGATGCTTCGAAATTGGCATACATCGGTGAGGAATCCCAGGTT
ACCTGGAGTAAATATCCTACTCAAACATCTTACCATCTGCACGTAGGCAGTCGACACCGTATCTTTGATTGCGACGGTCTATTAGAGCACGGTTTGGTCG
GCTCCTCGCGTGAGGTATCTTTTTTCAGGTAGTATTTGCCGATGGGCGCCACAAACACCAATATATTGCCTTGAAATTGTTCCGCTGAACTCTTTATGAT
ATTACTGAAGGGCAATCCACTATCTTCCGCATACATTGATCTTACGTGCATAGCTGACGTTCTTACTGGCTTATTTCCGTAGCTACTGACTGACAGAGTG
GCGTAGATCCTTTCCGAGTGGCATTTACTGGTTCCGATATGTATGCCGAACATAGGAAGCCAGATGACTGTAGGATGATTATCTGATCGTATACATCTTA
GACTTGAAGCGAATAGTAGCTTATGTACATTAAATGAAGTACTTTCGCTGCCTACTTATCAACTCGGCGTGCTTTTTATGTGTCCGGTCCTTATCCCGCA
AGGTGTATATACCACGTGCTCGTGATAGCCAGAACATATGCATAGGACCACTGTCGCTTTCTCGGTGCATTTGCGTCGTCGTGCTGGCTTACGGTGCTTA
CGCTTCTGATGTGTCAGTCTATATGACCAAGCAGGTCACTAACTGGACACAGGCCATACTGCAGCGATACAGGTATGCTGAACGCGCGTCTGCTAGCAGT
AGCCAACGCGATATATACGCGCGAGGCGGGCACACCTTATAGTCATCCGCGACTCAACCGAGCTCTTATTTCGGTCATTATGGACAGGACACCAAAGTAC
AATATTGCGTTCAGACACATCGACTTGCCACGTCCATCTGTCCGGTCTGCACTGTCACGCAGTGGTAGTATCTATGTAAACAGCAGTTCATTCGTCGCTC
GTAGTTCCCACTCAATACTGTAGTTTAAATGTGTGAGCGCCAATAAGTGCAGTATACGCTATAAGAGCTGATGGTACAGATAGCATGGTTTTGCGTGTGT
CCACGTGAGCGAGTGTACGTGCCATCTACGGTGACGCGTATGCGGATAGGAACCACCAACTTGCAGCGGTGCACAGTTGATTCCATGTGCTAATTATTAT
ATGAAACGCGCTACGCTCTATAGGTGCGTCAACACTATAGGCAGCGCCATAGTCAGTTTACCGTATGTGCGTCTCCAAGCCTCGTACCGTCAGCCAGTAT
ACAAATTACAAAAATAGGTAGGAAAATGTGAGTAAGTTAGCAACATATATTGTTTTAACCAATTACTTGCGTCCAAATATTAGCCAATCGCTTGGAAATA
TAAGGCTGGTATTTATTATTTAGAAACATATTAAAAAGTTGATACTAACGTTTTGGCTTTGCTATAATATATTAATATCAGATTCCCAAACAAATACATA
CTTTACATGCAATATAAATTGCCTAAAACAATTATCGATCGTGCGCGCATGCATCCGTCGGGTGCGGTGCACGGGAGTAGATAGCGCAATGACCGTGCAG
CCGCGCGCCTTCATTGCACGGTGGCAGTGGTGAGTGCCAGGTGACGTAAAAATATATATATATATTATCGCAAAGTCCCTACAAAAAGCGCTGGTCGTGA
ATCCTACTTTAGTATTAAAAAATACTATCGTCTCTACTTTAGAAAGTGTGTGAAAAATAGCATCGCCGAGCTCTTACAAATGGCCTGTGACGCTTATATT
ATAAATATTAGTACTATTAATATCGTCTTTACTTTGAAAAGTGTGTGGAAAATAACATCCCTGAGCTCTTACAAAATACTGGGTCTGTGAAGTCTACATT
AATAATGATAAATATCTCTAAATTTTTTTTTGAGAAGTGTGCAGAGCTCTTAGAAAATAAAGTGGTTAGTGTGCCCGATTTGCAGTACATACGACAGGTT
TTGCGCAATAATCAAGACCTCTATTTATTATAAATCGAGCATCAGGTTAAGTAAAAAGGACAAAAGCGCTGAAATGCACAATAGTATGTATCGATAATGT
AACGGGCCTAGAGAGTCCGTTACTAGCTTACATGTAATAATGAGGAAGCGTGCAAGTTCCGCGATAGTGAAACCAAGTGCTTAGTCTGAAGGAAAATCAA
CTCTGTTTTTATTTAGGTCCAGGGCAGCTTGCCCTGACCACTCAAATACACGTCAAACCCTTATTGGGTGATAATGGGTCTGGCTCCCCATATATCAACC
AATAGGATGACGGCAGTTCAGCACACGCTAGCCGTGTGCTGCTGCACCTACTTTTGTAATATAAATCTACCTACTTATGTAATGGCGTGGCCCACTACAT
CACCCCCCCCTCTTAAAGGTGCACTTAGGCGACATAAGCGACGGGGGGCGAACAATTCAATCAAAAGGGAAAGAGAAGAAATCCAGGTCCACAGGAACGA
ACGAGGGGGAGACGGAAACACATCCTGGCCCACGCTGGAGAAGGACAGGCGAGTTGCCCGGTAACACTGGGAGCGGACGATTGAACGGCAACAGCAGCAG
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGCCGCTCC
GCGGACGCTAGGGCATGATTGATTGGTGTAGAGAGGGTTGACCACCTCCGCTGCGCTGCGGTGAGCTCAGAAACCCTTACTCAAAGCAAAACTATATTTA
GAATATAAAATATACTGTGCTCAAGTTATGTTGGGTTGCAACAAACGATGTACACAATATCCTTAGTGCTTACGTGTTCTACATCACCAATTGCCTGTCA
GCCTACCTCTTGTATTATTTGAAGTCATTTTTGACAGCTTCACTTATAAGAGGTCTGCGTGACGACTGGCTGTTACAAATAGATACCCGCGTGATGGATG
GCTATTGTTGAGCATCATGGTACAGGTAGACGTGACAGTAAACTATTGTGAAGATGAAGTATTCGCCGTTACCACCGGGGCTATAAGTCATCTGCATGAT
GAACACTGTCTTTCCCTAAAAGATTTGTCTTAATTCTCGGCTGAGCGCTTCGCTCCTGAAATGCCACACTTTCAGGTGCGCTTCATTGCAAAGTTACTTT
CGGTTATTTAGAAGGTGGATCAGTATTATTGGTGCGCCAAACCTCAGCATAAATCGGTGAGGAGATCCCAGATAAGTTTAGCGCTAGTAAATACGACGAC
CGAAGTGTATTGGGATACAACGAAATCGGGTGAATTGAGTGACGTGTACTATTTGTCTAGCCGAGAGGTATTATATACCATATAGCTGATTGCGACGGTC
CGTTAGAGCGAGTTTGTCTGTCTCTGCATGAATATTATTGTTTAGAGCCGCTAGTATCTGCCGAGGGTCACAGAATATACCAATTTCGCCTCTCCATATG
CCTCGCTGAGCTCTTCATAGTATCATGATATCATTGAAGGGCCTGTACGTGATGTTCGCTGACTCGTATCAATTAAATTAATAATAAATTTAATCTCATA
ACCCTTCTATGATAGGATGAACGCCATTGACTGACTTACCGACTTATTTGCATAGCTAATGATTATCAGAGATCCGTATATCCTTTCCGAGTGACATTTA
CTGGCTCCGATATGTATGGCGAGCATACGAAGCCACTTGGCTGTAGGCATATTATCAGATCGTAGTGATACGTAGACTTGTATCGAATAGTAGCCCGTGT
ACGT