Description :
From Genome Similarity Track
Location :
Scaffold_266:41762- 46585
Sequence
4823 bases(100 bases per row)
CGAATGCCGAGCGCACGGCTCGATACGTGCATGAGGAAAAGCTCAAGCAGAACATCGATGGACAGACGGAAACTAACATGCCGTGTCGATCGTTTTTCGA
TTGATCGATCGTCTGCGTCCGTACGTTCAGAAGTAATATCTACGATGGACCGTACGAACCTCAAAAGTCTCTTTTTACACAGTCTTACGGACACTTTTTT
ACGTCGCTTTTTCTGGACCAATATATAGGGAGTCAAGACCAAATAGAACACTATTAACGGGACGGCCAAGAAGACGAGTGCAATTTTACGTTAACGAACA
TGTACCTGTGCTTTCGATCAAGATTGATAGACAAAGACAAGGGGCAGCAATTTTTTAGGAAACGCCACTAGATGCGTCCAAGAGCACCGTGTTACGGACG
TGTGGAAGTCAAACGAGACGCCTGAATGGTGGATGGACCTGCTGGTACCAATGGACCAGAGTAAAGAGCATCAGCTACACCCTGAACATCAGATACTTGT
TCACTTACTTACTTGCTTGTTTGGTAACTTACATTTATTGTTCCTCGCTTGTGCAGACCTCCAGTGGACTTTTTAGTGCTGAGTTTGTTACGGGTGTGCT
AGAACCCACAGCGATGAGCCCATGCCTGGACTGCATGATCGGCATCTTTAACCATCGTCCTTGCGAAGGAGGGCAAACTGGTGCCCATGCGAGACTAGCA
ATTCCAAAATAGACGTCCAGCATAAAAAATATAATAGTAAAGACACGTCTCGTCAATCGAAGAAGAAGTTAAGGTTAATGTTATGTTCATGCATATGGGA
GGATTACGTACGCTGGCAAGCGACATAGCGCTATCGGAACTAGCAAAGCGGAAGAAGCGGTAAAGGAAGGAGAAAAAGATGACGGTATGTGTGGTACAAG
TAGTACGTGGCGACAAGGGCCACTGACGACTCGGGCAACGTGTTTATAATATCAGTAACTTGCGTGGCTTTTTGAACAACGTTTACTTAGGGCGGGGGAA
TTAAGGGCGGGTAATGTAAATAGTTGCATAGATGATGACAAGAGTGAAACACTTGCAATCTTGCGCCTCCATATATAAAACAAATGATTTAACTGAAAAC
TAGCAGGGATTTATCCCATTAAATCCTATCGTAAGATAAAGGAGCAAGCTCCAGAGCTCGCCCTTTGATATATATAATCCAGCTCGGAGAACTGAATTAA
AATGCAAAACACAGGGCTTCAGCAGTCAATGAAGAATTAGTATGATACTGTCAATGTTTGTTTTTACCCTGTAGAGTATACTCGGACAACGCGATCAGCC
TTTGCTTATGGGCGTCCAGCATTTCCTTATACGATCATATTCACCTTTGATCGATTTAAAGCCAATCACGTGCGTGCGTCACAATATTGACCTAGCCAAA
GAGTGAATCACCTTATGTCAATTTATTAATTAGGGGGATATGCAAGATCGCACTTAATACGACGTTAAAGGCACACCTAGCGTTATTTACACACACAGAG
ACGGACACACAGTTCGGTAAGTACGATTTAAAAAGTTTGGCATCACCTTGTGCTCAGTCAGTAATAGCTTCACCCTTCAGGCTCGCAATAATTCAATAAG
GTAGTGGATGGATGTACCGTCTTGTCGCGAATGACATAAGATACAATGCCCCTAGTTTTGCCCACTCTTAGTGTTAAATTCGTTAAATTTGTACCGTCAC
CTTGTTGTGGTGATGTGACATACAAAACAAGCCGATATTGAATGCCCCTTCCTTACATCACCAAAGTAATTGCATTTTGCACGTCGTTCACCGAGCATTA
TGGCTGCGTGGCCATATATTCCATTAATTTTTATTGCTAGACCGAAGGGTGAAACGCATAGTGACTGCGCAAGGTGAATGCAGAGCTTTCTAAACAATTT
TTTTCCGTCTGTGTGTGAGTGTCTGCAAATAACGATAGGTCTACCTTACATATTGTACTAAGTTCGATGTAGGCTGTATCCCTTCACACATGTAAATATG
CAACATGTGTCTTTCGTTGATTAGGTCACTACTTACAACCATGTAGAGAGTGTAAGTCATGCATGCACATTTGCCCGTATATGATTGACTCGAAAGTGAC
TAAGGGCGATAGAGGAATAATAAGCAAGTGCTTGACACTTAGGGGCAGCAAAAATCGTGCACTTTCGGCAAACTGTAACTGTGTAGTGTTTTCATTTGTC
GTACTCGATAAGTTGAAAAGTGATAAATTATGGTCAATTTTCTTTGTCGGTGGCAGAGGGAGTTCCCTCAGTTTAACTTATATTGCTCATTGATCAATTA
TATGTCGTCGGCCGCACTTTGCGGTGATGCCGCAAACGGGAAGGATCATCCTCCGTCTCTCTCCATAGCGTGCTCTCCTATCATATTATATGGGTGCAAT
TTTCTATCGCTAATTGTAAATTGCTAAGCAAAAATCATTGATTTGACAATCTAAATTTGGCTAGTGAAAATGTTTTACATCGTGTGCATACTTATTGGAA
CATGGTAGTTATACTGATCGAATGAGTGAATCTAACAATTTCCTTATAGAAACAATCATTCTTGTTCTACATAAGTGAGTTTAATGACGGAGCAAGTCGT
TATGTGCATGTTCTACGTCTTTGTGCACATCATATCGAAAATTTTGTGTGGAACGCGAGAGCTCTCATCTTAAGCGGCATGAGTAGCCCAATTAAATCGG
GTAGCTACAATGAATATGCATCGTTCCTCTAACGATACATATTTATTGGATTCTACTTTACCGATCTTAAACCTTACATGTAAGTCTAGTTGATAAAATG
CTGTTACATGTAGTGTTATATAAGCAAAAATCCATCCTCTTTTCGGTAGGGTTTGAAGATTGCTTACTGTTGCGAGTTATACAGATCAGTCGCCGGACGT
CCAATAGACTTTTGATACCTACACTATCGCCATAGGAAATTCTGACGTCTAAAACTGTACTGCGTGAACCTGTGCGAACGCAAAATAGTTGGACTCGACA
GAATCATCCGTACGCTTTGTTTGATTACAATAGGTGAGTTTTAAACTGAAGTACCTGTCTCTATCTAAGTACTAGACGAATTATAAAATGGTCTCCAGAA
CCACATAGTATATGATTAGTCTTCGCCGCTCACGTGCGTAATCACGATAAAACCAGTCCAACTCATTTTCCAGGATGCTGCATTCTATTCTCAATATGGT
GTTGCTGTTTGACACTAAGATATCTGAATAGACAAAAGCGAGTGCGCTCATGTTCGAATCGCTATTCACAAACGACCTCCCACTTCGCTTTGTGCAAATC
AAGAGAATATTATGGATGCGCTAAGTGTCAGATACGTATAGGGCATATTTATCAACTTTACACGCCTATCCACACCGATCTAATAACCTTGAAAAAGAGC
AGGCGACCGACCAACTATATAAATTAGTTTACAGAGCCTCGCAAAATACGAATCCGTGCTCATACTACAGGTATCGTCGACACACAGTGCTGCTGGAGAT
CGCGCGGCCTTTCACAGCTTAACCCTTGCTGCGTACAAAGGTGAAATGAGACCGTACGTTAGATAATTGTGGGCTCTGTCAACGCAAATATGTAACAGTA
GATAATTCTACTTCTTTCGATCGATAGTATCACGGTAAATGCTCGGGATCGTGCTTGCCTAACGGCAAGGGTTCACCAAAGTGAAGGTTGTGCGGTGTGA
ATAATTGTAACAGCTGCGTCTCGTAAAACTTGCATTCAAGGTTTTTGTCAATTCACCAGGAGACAAAGCACTTCACACGTCATTCTTACCGACTACCCAT
ATTTTTGTCGTCTACTTCTTAGTGTGCTTATGACTCATTACGCGGTAGAGCTGTCAATGGCGTTGAATATAGACTTAGAATTTATATGGATAAACACTAC
ATCTCATCGAAAGATAAAGACGTCCGGCAAATTATTGTGCAGTATGGTGGTGAAGGCGGCATTCTTTTTGGTGCCCAGGGCGGCGCAAAGAAGTAGGAGA
TAGATGGATGAGCTTCAGCTACGATAGTCTGGCTGCGAGTAAGTCGCGTGCACTGATGGTTCGAGCAATAGACGTTCATTGCATAGGTCTAGTCCCTTGC
ACCTACTAGTGATAAAGGAATTTTACATGAACAGCTGCATTTCCGAGTCCTTCGAACAGTAGCAGGGTAGGTATCACACATTAACTGTATGCCGGTTAAC
TGTAAGCCTTTATTTTGTCCAATGTGTCAGGTCGGTTTACTCCTCAATCATACTCGATGTGCGTGTCGCGAATCGATTGGCTGCAATGCAATCACCTGAA
TTGCGTAATCAAGTTTGGAAACTCGTTCGCCGCCCGTTTAACAGCTGCACGATGATGGCGAATTGTAGCACCAACAATCTTAAATTTACTGGTCTCGCTG
TTGTCTATCGGAAAAGATTATCAGTAGATCCTGCGAAAGCAACATAGCCAGCACTAAAGAAGTCGACGTCTTATTTTCCCCGGGTGCTTAAGATGGTGTT
GCTGTTTATTTCATTGTAGCGTTTGTCTATGTACAATAGCAGGTCAGTGTCAGGGCTATATTTTGTCATCAGTTCTTGTCCCGCCTGACCCCCCCCCCGT
CGAATTCTCTCCCACGTCACCGTGCACTTAAGCAGACAATCCTTTGATGTCGAAAAGTATAATGACTCAGGGGAACCTTCATCCCGACATATAATGCGTG
AAGATCGGATATGTCTGAACACTTGCTGTACCGTGTTCATAACAGAAATTAGCTCTTGTACTCATTTAGACGAGCACTAGACATCACATTTCCATTCAAG
AATATCGCGTTTCAAAAACGCGT