Description :
From Genome Similarity Track
Location :
scaffold_178:41762- 42861
Transcript NameFunction/comments
g786.t1 hypothetical protein PHYSODRAFT_344027

Sequence
1099 bases(100 bases per row)
CCAGCTCGGCCTTGTTGTCGTATAACGGCAGTTCCACACGGTTGAAGCACGTGTGCACCTTGGGGAAGCCGCGAGTTTGCCCAGGCAACGGCCGCAACGA
GAAGGGGCAAATGCGGCCGTCATAACTGGTTAACCCCTTGAAGCCCTGCACTGGCACGCGCGATGAGCCCGTGGAGAACTGCAGGAATCGTGCACGTTCG
TCCTCCGTGAACGCCTGAAGTACTTCCCAGAACCAGCCAACGACGTACGGGGCCTCGTCGAAACTGGGAGCGACCACCGTGTTGCGCTTCCAGTCGGCGA
GGTCGATCTCGGGAAGTCCGCACAGCACGAGCTCAAGCTCCTGGTAGTCGAAGACCAGCAGCGCTTCCTGTGGGACGACCTCAAACAATCCAAGAGACAG
AGCTTGCAACTGCGGCCCGTAGCGATCGAGCATGAGGTAGCGCAGCTTGAGGTGCAGGAACTCTTGTTTGTTGGCGTCCGTCACGGGCTTGTCCCGTCCA
TCAGACACCAAGTCCACAGTCACGACTTCGTCATCCGCTCGTAGCTCCGTGACGGAGAACGTGAGCTCCAGGGCGTCCACGCCGTCATTGTCTCGGATCC
AGATCATGCTCGTGTACACCTCCGGGTCCACGTACTGCAGGTCCGAGAAAGTGATTGGCGTGCCTAGGAAGTGCTTGAGAATGGGCAGACACAGCCGCGC
CTGCATGGTCTGTCCTTCCAGCAGGGCGCGGCCTAGCAGTCTGCCAATGCCCCGGAAGTAGAGCAAGTGGTCGGCCGTGCAGTCTTCAGAGTGCGGGTTA
ATAGCCACGGCCTGCGTGTGTCGGTGGCACGACATAAAGAGCCCCAGCTCATCGTCCAGCAACCTGCCGAACAAGATGGAGAACCATTCTCGCTGCAGAC
CTCCGGCGTCGATACCTGCTTCCCCGACGAACTCGATGCGAAGCGGGAAGTGAATGTGCTCGGGCTGAATGCCCAGCAACTGCTCCATGCTCTCCACGAG
AATGTGTTCTCTCTGCACGCGCAGCTTGATGCGTCCTTCTTCCCACGGCCTCAGCAGCGCGCCCATGCGTTCCAAGAACCACGCGTACTTCTTGGGGAA