Description :
From Genome Similarity Track
Location :
Scaffold_591:4176- 7872
Transcript NameFunction/comments
Physo_145188hypothetical protein

Sequence
3696 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGCAGGCGATGAATCCACTTGCCTTCTTGGATAGCCAGACTGAGCGCGATGTACT
CCGCTTCGCTCGTGGACAGCGACACACTTGATTGCTTCTTGCTTCCCCAGCTCACAGGCGCACTCATGAGCATGAACGTGTAGCCTGAAGTGGACTTGCG
GTCGGCGAGGTCGCCGGCCCAGTCCGCGTCCGAGTAGCCACGAAAGTCGATCTTGTCGCCCGGCTTGAAGCAGATCCCATGCGTCTTGGTGCCTTGCAGG
TAGCGAAAGATACGCTTGACCGCAACCCAGTGTTTCTCTCGGGGGTTCTCCATGAAGCGCGATACATAGCCAACGGCGTACGCGATGTCTGGGCGCGTGG
CGGTCATCAGGTGCATCAGAGCACCAACAGCTTCGCGAAACGGAGCGTTCACCTTGGTCGCCGCGTCGCTTGGAACCAGTCGAGTGCTCATGTCCACCGG
ACTCACCACGGCCTTGCACTCGTCCATGGCGAAGCGCTTCAGGATGTCGTCCACGTATCGCCGCTGGCACATGGTCACGCTGCCGTCCGGGCCGTCCACC
AACTCGATCCCAAGAACAAACGCGCACTTGCCGCTGTCGGTCATCTCGAAGCGCGTCTTCAGGTCGGTCTTCGTGCGTGCGATCAGCTCGGGCGAACTCC
CGGTAATCAGTACGTCATCCACGTACACCAGTACAAGCACGCAGTGACCGTCCACCACCTTGATGTAGAGGCACGGATCGAAGGCCGACACTTGGAAGCC
GATGGAGCACACGAACTCGTCGAAGGTCTCGTTCCACACTCGTGAAGCTTGCTTGAGACCGTAGATGGCCTTCACCAGTTCCAGGCAGTCGAAGTCACCA
TCCAGTTCGACGCCTTCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCCGACATCTCCATGCTGAAGAGTGGGCG
CTTCAGGTAGATGCGTCCAGCATTCTGCGAACCACCGTACAGCGTCTTCAGGCGCGTCCACGCAACCCACGCTTCCTCGCAGTCGTCGACCACATGGTGG
TAGTCCGCGTCCATGTGGAGCAACATCAGTCCGAACGCGATGTTGCTCGACTTGACGTAGTCGTCCTTGGCCCGCGAGTCCGTGAAGCTCGGCGTCGTCT
CGCGGTTCACGACATGCCACGTCGACTTGGTCAGGAACACGCCACGCATGTAGCGGTTCCACGTCGCGTAGTTGTCCCCGTTGAACTTGTCAATGGAGAC
CTTGGTCGAGGCGTCTTGGGCAGAGGACATGGTGCTTGGGCTCATAACCTGATGGAAGGTATGGATCTTGGACACGAAGCTCGGACGAAGCGGAGGGAGG
GACGTCGCAGACGGCGGGACCGGAGCGAAGGCACTTGAGGGGTAGAATGAAGATTCGAAAGTGATTGAATTGTTGGAGCTTACACCCTACTGTTATAGAC
ACGCGACCCTGCGTCCTATCACCTAGTGCATCTAATCAACCATCACTCACCGGTGTTCATCCAATCATCCTACTCGTCTAATCATCGGTGGCGTAAACAA
CTTACCGTAATCACCATAATCAACGTGTGTTCGGATTGGACCGGTTCGGGTTAACCGGTTAATGGGTACAACTGGTACACAGTACTCAAGACCAGCAACC
CTCAATACTGTTGATCTGGGTCGATCTGTTCACGGGATACGTGATCGCGAAGGCCAGTTCCTCCCGAAAGGCGCAGACGATCGCCGATTCTTACGAAGAG
TGCGTGTTCCGGCGATTTGGTTCTAGCGAGGTGATCAGGCACGATCGAGAGCCGGGTTTATGGCTGACTTCTTCCGCGCCTTTAACAAGATCCTGGGTAT
GCGCCAGCGAGCGACGATCGCATATCGACCTCAGGCTAACGGTACTGCAGAGCGAATGATACAGACGGCGACGAGAGCCCTGAAGATGTTCGTGGAGGAT
CTGGATCAGAGGGATTGGGATGAGTACGCAGAGCGATTGACCTTCGCGATCAACACGGCTCAAGATCGGGTCCGTGGGGACTCCCCTTTTTATCTG