Description :
From Genome Similarity Track
Location :
Scaffold_1176:4176- 6458
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1176-fgenesh-gene-0.0Propionyl coenzyme A carboxylase (Pi-PCC1)

Sequence
2282 bases(100 bases per row)
GCAGGCGCTGCTCTTCCCATCCACTGCCACCGCCAGCAGCAGCAACCGCTGGTTCGCGGCGCAGGCAGTCGCCGCCCCGAAGGAGAAGCTCTTCGACAAG
ATCTTGATCGCGAACCGCGGCGAGATCGCCGTGCGCGTGATCCGAACGTGCCAGCGACTGGGCATCAAGACCGTCGCGGTGTACTCGGAGCCGGATGTGA
ATTCGGTCGCGGTGCGCATGGCGGACGAAGCGATCTGCGTGGGGCCGGCGGCCTCGGCGCAGAGCTACTTGAGCATCCCGAAGATCCTGGACGCTGTGAA
AGCCACAGGCGCGCAGGCCGTGCACCCTGGCTACGGCTTCTTGTCAGAGAACAAGGATTTTTGCGAAGAACTGGAGAAGATCGGCGTCGCGTTCATCGGC
CCTGGCCACGAAGCGATCCAGGCGATGGGCGACAAGATCGAGTCCAAGCTGCTCGCGAAGGAGGCCGGCGTGAACACGATCCCAGGCTTTCTCGGTGTGA
TCGACACGGCGGAGGACGCGGTCAAGGTCGCGCGCGAGATCGGGTACCCTGTGATGATCAAGGCGAGCGCTGGTGGCGGCGGCAAGGGCATGCGTGTCGC
GTACGACGACGACGAAGTGCGCATGGGCTTCCGTTTGTCCAAGGAAGAAGCCGCAAGCAGTTTTGGCGACGACCGCATGTTCATTGAGAAGTTTATTGAA
GACCCGCGCCACATTGAGATCCAGCTGATTGCGGACTCCTTCGGCAACGTCGTGCCTCTCCCAGAGCGCGAGTGCTCGATCCAGCGCCGCAACCAGAAAG
TGATTGAAGAAGCGCCGAGCGTGTTGCTTGATGACGCCACGCGCCTCGCGATGGGCAAGCAGGCATCTATGCTCGCGAAGAAAGTGGGCTACGTTTCGGC
TGGTACAGTTGAGTTCCTCTGCGACAAGAACAAGAACTTCTACTTCTTGGAGATGAACACTCGTTTGCAGGTCGAGCACCCAGTCACTGAGCTCATCTCG
AAAGTCGACTTGGTCGAGCAGATGATCCGCGTCGCGGCGGGCCACAAGCTCCCGGAGCACTTGCTGCAGGGACCAGTGAAGATCCACGGCTGGGCTATGG
AGAGCCGCGTGTACGCGGAGGACCCGTTGCGTGGCTTCTTGCCGTCGATCGGGCGTCTGCTCAAGTACCAGGAGCCGGTGCACCTTCCGGGCGTGCGCGT
GGACTCTGGCGTGACGGAAGGCAGCGACATCTCGATGTTCTACGACCCGATGATCTCGAAGCTGATCACGCACGGCAACGACCGTCACGAAGCGTTGGAG
CGCATGAAGGTTGCGCTCGACAACTACGTGATTCGCGGTCCAGGCAACAACGTGTCGTTCCTGCAGGATGTGTACCGTCACCCTCGCTTTGTGAGCGGCA
AGATCACGACCAAGTTCATCGCGGAGGAGTACCCGGAGGGCTTTGAGGGCGTGAAGCTCAACAAGGATGAGCTCAAGGACTTGACGGTGGTCGGCGCGAT
CATGCACCTGCAGAAGGCGCACGCGAGCGGCCAGATCTCGGGCCGCATCCAGTCGCCACGCGACGTGATCAACGGATTCGCATCGGTCAACGAGGATGAG
CTCGAGTTCATCTCTGGCCACGTCGGTGTTGTCCCTCGCTTCCGCGTGGCGCAGAGCGGCGTGTCGGGCGAGGGTTTGATCGCTCTCGCGGAGCGCAACT
CGCTCGTGGACCTCGGTGAGATCCTGTACGTCAGCGTCGATGGTCAGTTCGGAGAAGCGAAGGAGGTCGTGGTCGTGGAGCTCGAGGTCGAGAACAAGCG
TAACCGTATTCAGAACGTGACGCTGGCATTCGCGGACGGCAAGTGGCACGTGGTCGGCGACCTGGACTGGTCACTGAACGCGCCATTGCTCAAGGCGACG
TTCATGGAAGAGCAGGGCGTGAGCAAGTCGGTGGCGACCCAGCTGCTCGACACGCTCCCAGAGGGATATCGGCTTTTGCACCACGGTGCTGTACACGACG
TCGTGGTACGCAACGACCTGGAGGCCAAGTACGCGAGCTACATGAAGCCAAAGCCAAAGGTGGACACGTCGAACCTGCTGCTGTGCCCGATGCCGGGCAT
GCTGATCTCTGTCGCGGTGGAGGAGGGTCAACACGTCGAACTCGGCCAGGAACTCGCGGTTGTCGAAGCCATGAAGATGCAGAACGTGCTGCGTTCCGAG
AAGAAGGGCGTGATCAAGTCGATCAAGCACATTGCCGGCGCGTCGCTCAAGGTCGACGAGATCATCCTCGAGTACGAGTAAA