Description :
From Genome Similarity Track
Location :
Scaffold_1144:4176- 6159
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1144-snap-gene-0.3Major Facilitator Superfamily (MFS)

Sequence
1983 bases(100 bases per row)
AGTATTCGTTCGCGAGCAGAGACTTGTCGTCGAGGTCCGCGTCCTCGTCCAGCATGAGCGACGCCGCGCGGATCTTCGTCTTGCTGACGCTCGATCCGTT
GAGAATTGAGCCGCTCTGGTAGTCCACGACATTCAGAGCGATGCCCACCAGACTGCCAACCACACCGAACGAGACGAACAACAGCTCGACGCCGGGGATG
TAGCGGTCATCGTGGTTGTGTTCAGCGGCCACGGCGAGAGGGAACAACGCCAAGCCAATATTCTACAAGCACACAACCGGCACCACAAACAACAATTTGT
TAGTCAGAGTCATTCAGCACCAGCACGCATCGTAGCAGCATTCGAGCATACCTGAATGGACGTGATGGCCCCATATGCGCTTCCCACGTGCTTCGCTTCA
ACCACATCTGCGAGGTCATCCCAAACGCGTGTAAGTCTCCACCAGACCACAATCCAAGCAAGAGCATCAATCTGAGCAATCGTACAGGGCACCGAGGGCC
ACAACGCAGCAGCAAACACACTGTAGGCCACACCCTGCAGCACCAACGGCACATAGAGATTGACGCTTGTCAACCCCAGCATGGCGTGGACGAGGGTGAG
CGCGATCGGGGCGATGAGCGCCAAGAACGCACGAAGCCCGATCCGGTCCACCACGAAGCCGAGGAACGGAGAGATCACGGCTGAGATAATGTACGGGATG
CTCATCGGAGTCGCCGCCTTACGGGCCGCGTCGCCCTTCTTGCTGCAGAACGCATGGGTGAATGGGCCGTTCTTCCAGGCGTCATCGTCACAGTTGATCT
TGCTGTCGTCAATCAGTGGAGGCGTGCTCGAGCAGTTCCATTGGTCCAGCGGCTTCTTGATCGTGCAGTTTGCAGAGAGGTTCGGAAGTGGCCAAGCGTA
CGGAGGAACGCTCGGACAGCCCGGCGCGATCACATCGCATCCGCGATCGAGATAGGCTCCGACCTCACACCGCCGACACTCGACTGGCGGCTCNNNNNNN
NNNNNNNNNNNCGCTCCATCAGCAAGCTGCTCGCCACGCTGTTGAACGGGATGACGCAGCCATACACCACGAGACAGCTCAACGCGAGCAGCCAGAACGC
CGGGCGGAAGTGTTTGATGTCGCTAAAGTGCGTGCGCTGAGCGGTCGGCGTGGCATTCTTGTCGGCAGACGAGACCTCGGCTCGCTTGTCGATCGGGATC
ACGAACAGCACCATCAGCGACGACATGACGCACATGGCCACGCCCACCCACAGAGCCGCTGAAACTCCTGACGCCTGCGCAATGACGGGACTCATCTCGT
TGTTGATCACGCTGCCCAGTCGCGCCACACTGAGATTGATGCCCAAGGCCAGCGCTGCGTCCACACGACAAGCCTCGTGTTATTCCCCACACCAATAGAT
AGTGACAGCACAAAATACGAACCGAGTTCGCTGTTCTTGAACCAGGAGGCGACCAGCGTTCCCTGAGCGACTCCCAAGCTCTCGCCGCCAAAGCCGAACA
ACACGCGACCGGCCTGTCACGTCCAGCCCTTTCGTCAGTGCGTGCAGGCCATTGTATACAGAGGAGTGCCTCTTACCAGCATCAAGTTGAAGCTCGAGAG
CGAGCAGCCAGACGCGAACACGATTTGCCCAGCCAGGATCGCCGTCGAGAAGACCAGCAGCATGGCGCGCGCACCAAAGCGGTCCACGAGCACGCCGCCG
AAGAACGGGAGCGCGATGTTCGGGATCGAGTACAACGTGTACAGCAGATTCTGATCAGTTTCCCAGCGTCAGTCGGCGTGCGCAGCAATTGCATTCAGGG
TTGAGAGAAGTAGAACGGACAAAGAGGAACTCGTAGCGCTGCTTGGGGAACTGGCTGAAGTGCTGCTGCAGCTGGCTCTTGAGCGCCGCGGGGTTGTCGA
AGCAGTAGTAGTTGCCGATCATGAGCAGGCACGAGAGCAGCAGCACGAGCCACCGCACGGGCTGCTGACTCTTCTCCATGGTT