Description :
From Genome Similarity Track
Location :
Scaffold_27:417475- 419469
Transcript NameFunction/comments
Physo_133712glycoside hydrolase, family 3 domain protein

Sequence
1994 bases(100 bases per row)
CAAATGACCAAGTCGACATCAGCACCGTCATGAACCCCAAGGACAATACCCTCAACGAGGACTGGGTGCGTCTGTATGCCCAGCAGTATGTTGGCTCCTA
CCTCAACACTATCTGGGACGAACCCATGGAGGAGAAGTATGGCTGGACCGCGTCCGAGTTTCGCGCTGTAGTGAAGCGCATCCAGGAGATCTCAATGGAG
GAGAACGGAGGCCACCCGATCATCTACGGCCTCGACTCGGTTCACGGCGCCAACTACGTCGACGGAGCTGTCATTTCCCCCCAGCAGATCAACAGCGGAG
CAAGTTTCAACCCCGACCTCGTCTACGAAACGGGACGGATCACGGCGCGTGACACCCAAGCGGCTGGAGTCCCGTGGGTCTTTGGCCCCATTCTGGAGAT
CTCCCAGAACCCCCTCTGGTCTCGCACGTACGAGACCTTCGGCGAGGACCCATACCTGGCGGCCGTGATGGGAGACGCCATTGTCCGCGGTCTCCAGAGC
TACAACCAAACGGCTGCCTGCATGAAGCATTTCATCGGATACTCCAAAACCCCAACCGGTCACGACCGCGACAACGTCATCATGGCGGACTTCGACCTGC
TGAATTACTTCCTGCCGCCGTTCAAGGCTGCCATTGAGGCTGGCGCCATGTCGACGATGGAGAACTACATCTCGATCACGTGATCGCGAGCCCTCGCATT
CTGAATGACCTGCTCCGCTCGGACCTTGGCTTCGATGGTCTCCTGGTTTCGGACTGGGCTGAGATCAACAACCTCAAGGACTGGCACCGCGTCGTAAACA
GCTACGAGGATGCAGTGGCCTTGTCGTTGAAGGAGACATCTCTTGACATGAGCATGGTGCCCAACGACACCAAGTTCATTGAGTACGCGCAAAACATGCT
CGAGAAGTACCCCGAGAATGAAGCTCGTCTGCGTCAGTCGGCAAAGCGCATCATCAAGACGAAGCTGAAACTGGGACTATACGAGACCCCGGTGCCTGGC
GAGCAGTTTGTCTCCATGGTTGGCAGCGACGACGACAAGACTGCGGCTCTGAACATGGCTCGCGAGTCTATTGTGCTTTTGAAGAACGCCGAGGACGTCT
TGCCTCTGCCGAAGGACGCCTCCGTCTTCCTTACGGGCCACTCGGCGAACAACGTTGGTTACCAGTGCGGTGGATGGAGTAAGGCTTGGCAAGGATACTC
TGGCAACTCCATGTTCCCGAACGGCGTAAGTGTTCGACAGGGCTTTGAGAACTTGGTCGGCAACAGCTCGTTCACGTACTTCAACGGACTACTAGCGAAC
GGCTCCATTTCGGATGAGGACTCGGCTACAGCTGTGAGCCTCGCAAGCCAGCACGAGTACACGGTTGCAGTCATCGGCGAGTCCCAGTACACGGAGAAGC
CTGGAGACATTGATGATCTGGCGCTGCCTGAGGGACAGGTGAAGTACATCGAGGCGCTGCGGGCGACCAACACAAAGACGATCGTTGTTCTGTTTGAGGG
CCGTCCGCGCCTGCTTGGATCGATCCCCGACCACTCAATGGCCATTATCGACGGTCTCCTGCCGTGCGAGCTCGGCGGTCAGGCGATGGCTGAGATCATT
TATGGCGAGGTGAACCTGAGCGGAAGGCTGCCGATCACGTACCCGAAGGACCCGGCTAATATCGCCATTCCCTACAACCACCGCGTCACGACGCGCTGTA
CTTGGGACAACTGCTGGCAGCAATGGGACTTTGGCTCGGGTCTCAGCTACACGCAGTTTAGCTACTCAGCCGTAACTCTAGACACGACGCTGCTCACCAG
CGCGGCTGAAACGGTGACCGCCACCGTGACTGGGCACTCGCGCCGGTAAGGAGACCCTCATGCTGTTCCTGATCCAGCCGTACCGCCTAATCTCGGTGCC
GGAGGTGAAGCAGCTGAAGAAGTTCAAGAAGATCGAGCTTCAGGCCGGAGAGTCCATGGACGTCTCGTTCACGCTGACCACGGACGATTTGAGC