Description :
From Genome Similarity Track
Location :
Scaffold_24:41742- 48023
Transcript NameFunction/comments
Phyta_totarag1325hypothetical protein PHYSODRAFT_507752
Phyta_totarag1326protein kinase, putative

Sequence
6281 bases(100 bases per row)
TCGACGCACActgcgtgtacatgtaccggcTTGTCTCATCGACGGATTGGACGCGCTCACTTGAAGTGGCAGTGTCATGCCTGAGACCCAGGCGGTGGTG
ATGACGCATGCGCCGCGCTTGTCGGTGGCGTTCGCCGCGATATCTGTCGCTGTGGCGCTGCTTGCGGTCGTCTGGACGTCGCCTgactggctgctgcagc
gacttggcCACGAACCGCTCGTGGACAAGTACGAGAGTGAAGTGGTGAAGATCTCCACGCATCCGCTGCTAattggtggtgctgcagactACAAATGCGC
GGCCTTCCAGCCAACCAGCGACGAATTGACGCatgtggagctggtgctgggtcgggagcagcagctacaagACCAGAGCCAagtcttcttcatgttgaaC
GGGCAGAACGAAGGAATCTACTTGCCCTGGACGCACCGccaggacgaggaagcgTGCCTCTTGGAGTTGGCGCAGACGGCGGCACTGCATCTCGGAGCTG
GTCCGGATCGGATTTCCAATGGACTGAAACTTTTCTCCATCGACGGCTTGCCGATCTTCACGGCGGGGGAGTTGAATAAATTGCGGATCGCTCATGTATT
GCTGGACGGACAGCTCTGGGTATGGCCTGGAGTTAAGGTGGGCTACGTTCGTGAGATCGACGGATGCACCGTCACGACGCAGTCGCTTCGCCCGAAGGTG
TTCACAGTGGAAGGTTTCTTTACACCAAAGGAAGCGGATGCTATTATCGCCGAGGGCATCGACCATCTCGATCGCTCTCCTGTAGATAGCGTTGATGCAG
ATAACGGGTACCACGCCGACCGCACGAGCTTCACGGCGTTCCTGGATGACAGCCACTTCACGCGCGACCTCCGCGTGCGATCAGCGCGCCTTGCTCGTCT
GCCATCTCCTGGGTATACTGAGAGGATGCAGCTTGTGCGGTACAAAACTGGCCAATTCTTCCGCAAGCACGAGGACTACTTTGACTCGAAAGAGTTCGTA
CCAAGCAAACAGTTGGCTGGAGGTCAGTTTGAGGCATGGATTCAATGGGCGTCGTCCAAAATCGAGGAGCTTCGCCAGGAACATGGCGACAGCATTGTTC
CTGTTGAGTTCTTGCCTGGTGGCACAATGTTTCCCGACGTTCAGAGCACAACAACGTTTCATCATGCGCTACTGAAAGGCTTCatcgaagatgccgaagc
TAGCAACTTCTTCTGGGAGAACGCAGACTTGGAGTGGCGAGATTGGATTCACGAGAACCTTGAAAGGGAAGCAGAGAATATCATGGGACCGATTTTAGAG
AGCAAAGGATACATGCTACCGTTCATCGTTGCATCATGGGAAAAGCGCGCTGGGCTTCATGAACTTGTGTACTCCTTTCCCAAACTCGCGACCAGTGGTG
TTTCGCACTACTTTCGGTGGATACGCTGGGCAAAGGAACGTGTGCAGATGCTAATGGACACGCATGTGGAGGCTGTTCCGAAGCGCGTGAGACCCGAAGG
AGAAGACTACCCGACCTTTTACATGCGTTTTCAGAACCGCTTGGCCAACTACATGCTCGAAGACTATACTCGAGAGTTCCTTGTCGATACGCTTACCGAG
GAATTGCATGCGTGGCTCATTGAGAACAAAGACAACAACGATGTtttgctggaggtgctgcgcaATAGTCCTTCCGCATTCGACCTAGCGGTGGAGTCTT
GGACCAAGCGTGCTGGCGGTTTGTTCGTCTACGATAAACCGAAATATTTGTATCACTTCGAGCCGAATCGATTCACGACACTCTTCCTGTATCTGAACGA
CTGCCCCGAAGGTGGCGAGACGGTCTTCCCGTACTCAAAGGAACGCCTGGTGACTGGAATCGAGCGGGAGGGCATGGCCGAGTGCTCCGATGGTCTCGCT
GTACCACCCGTGAAACTCACGGCGTCATTATTTTACTCACAGACGCCAATAAACGACCTGGACCCTGCCAGTCTCCACGGCGGCTGTCCTCCAGCGAAGG
GTGTCAAATGTACGTTTTGTCATGTTGGAGTCTGCACTTCAACTACTGTATGGATAGTACCCAACTAATTTGTGTGTGTTCGCTCTTGTAAGTCGGAGCC
AACTCGTTCATGTGGAATGTCGATGCCGACGAGGGTGCCAACGCGTGGGGCATGGGAGAAGACTTTAAATCGATGACCACATAGCTCGACGCAACGCCAT
CGATGCAAGCTTTGGTCGCGAATAAATACGAAAAATGATACAAACAAATTCTTACACCAACTATAAAAAGCGAGCATCAACGGCCAAGGCGGTGGTGGAC
TGCAGCGTTCAATTCGACATCATGGGACACACGGCTAGCGTCAATAggcagcgacgcagcacaGCAGGGACGCTGTATGGAGAACCGGCAggcgcggctg
cagcaccgcgCGGGAGCTACACGCCGGCGCAGATGCAGGCGCTGTATCTGAGTCGAGGAAGGCCAGACATGGCGTTCATGTCCAATCAGGGAAGTACGCC
CGTTGACCTCCCagaactgcagcaaacaTGCACGGTTAAGAACCACGTGAACCTGAAGAAGGGCAgtctcaagctgcagcggtcGCCCACAGAGCCGCAG
CAATTCGCACTGGAATTCCAGTTCGATGCCACCAAACCATGTCGGATCAGTGTGTATTTGGTGGCAGCTGAGACCATCGACGCTGACACTGGCGGCTCCA
GCTTTGCTTTGGTCCATGCAGACAAGAACCCGGTGCTGACTCAGCACTTCCCTTCGGGATTGGGGCAGGTTTTCATTCTCAAAGGGGGTGAGAAGGAAGT
GGGGGCAGCCAAGGAGGGCCAAGAGAACCACGAGCAGCCGTTGCCGCTCTTGGACTTCTCAGCGTACGACCCTGATGAGTTGGTGTACAAGGCCGACACG
ACGCAGTTTCCATTGATCATTGTACTCGAAGTTTCATCGGATAGTAAGTTTGTGTTGTTGTAGCAACTTGGTTTCGTTGATGCTCTGGTGCTAATGGCTT
GCTGTGCTGTTCACAGGGAAACCCCCGCAATCTCAATCGACATTTTGCACGTTTCTCAGGAAAGGTGAAGACTGCTGGGTTATCAAGATGCTCAAGCAAA
AGATCCTGGTACGGAATGAATAGTATCCGAACTTGTCCGAGATGCAGCTCGATATGTTTATCGACTGATTCTTGTCCTCGTTGAATCGGCTAGGTGGGCG
GGCTGACGTATGAGTTGCAGGAGATCTACGGCATTGATGGATCGGTGACAGCAGCGCCCAAGACTGAGCGCAACGGCGCAGCTGGGGATGGCCAAACCGA
CTCAACCCAGCCTGCCAAGGATGAAATCGAGATTCCTGAAGGCGCCGAGTGCATCATCTGCTTGTGTGAACCGCGCAATACTACAGTTCTACCCTGCCGC
CACATGTGCCTCTGCAGCGAGTGCGCCGAAGAACTGCGCAAGAGCTCCAGTACGTGCCCAATTTGCAGGACGTGTGTCGAAGCATTACTACAGATTCGTG
TCGAAGTAAAGGAGAGTATGACGACGGAAGCTGAGACCGAAGTAGAGGATGCCAAGTGAAGGAAGGGCCTTGGAGTAAGCATAACGGTTTTTCAAGCTCG
TGTCACAACAACCACGATCACAACTGATATTGTCCAGGGTTACTCGTATCGCTCTTCTTTCAATTCTCCTAAGACCGTCGTCAGAAGCATAACGAAAGAA
TTTATCAAATTACTGGGTTCCTTCCTACCTCATCCTTGTCGTCTCGCTGCGTAAATGGATCACCGGAATCAGAAGTTACCCCTCGGCTTCGGTCCAGGTC
AGTCCTTCACACGTTAATCGGACTCTCTATCTGTGAAGACCTTATCATTGCAGGTGGCACGTTCGCCGCTCACAGTCCGGCAGCTGGGTTCCGCGCGCTT
GGTTTTTCTTGTGGGTTTTTGGTTGATTATCTTGTACAAATACTGATGGCGCCCGACGGTGCGTGTTTGGCGGTGAAAAAACTCGACAAAGGCGTTTGGC
CGCTTGTTCGCTAAGTTCGCGCCCTTCATTGTCGATTAGTTACACCAAACACATGCAGATAATACGTTACTGTCGCACCGCATCCCCTCCGCTGCTCTGG
CCTGTGCTCGTGCTCCGTCCCGCAGACTAGGTCTAACTGATGCCGTGCTCTTCAGGCCCCTTGCTGGGCGAGGGGCTCGGCACCAGCTAATTGTTCTTTC
TCCACATGCCCTTCATCTGCAAATCGTCCATAGATATAATCAAATCAATTAGAGAAATCGACATCGAGCGTATAGAGAATTGCAAACTTACCAAGTTGGC
GACTTGTTCGGGGGCGTCGCGGAGTCTGTTTGACGTCGACGAAGTCGAGCTGACATCACCCGTTGGGCCACAGTAAGGACTGCTCTGGCCTTTGGCAGGA
TAACCCCCACCGCGCTGAGATCTTGTCTGAACCTCCTCTGCAGCAACTTTCGCATTCAGCTCTCCAGAAGACTGCGACTGGATACCGCCACGACCGGGAG
GACTGCCACCATTGTTGTCTCCCCGCCGTTTAGGACTCTGCGGTCCTCcgtggttgaagttgttgtCTGCACTGGAATTGGAGTCATCGGAAGTTGTCGG
CGATCCGACCTTAGCGGCGTTGTACGACAACTTGCGCGTCATCATCTCTACCATTTGCTCCCGCTTCTTTAGCTCGCTTTCACGACGCATGTagtccacc
tccagctctgcaAATATAAAAAAAGTCTTCAGAACTTTGGCACACGACAAAAACAGGCATGACTCCTTCCTCACctttcagcttcttctcacGAGCCATC
AAGGCAGCCTCCTGCCGGCGCAGGTCTTCCTCAATACCcaacagctccttcatcttctggtTGTAGGACGTCTGCAAGTTCTGATCAGCAGCCGGCTGCG
GGGTGTTAGCCGCTGAGTACGCACGTAatctctgctgcagctgtggcACACGCTCCAAGTCCTCGATTCTCGGTCGTCGAGAGCGTTGCCTGTGCAGCAT
CCAGCGGATGACCTGGAAGAGGCCCTCTGAATACTGCGACGGAATCCGGGTGAACTTGCCAGCGTTAATTTTCTTGGCGAGTGCCAACTGGTTGGTCGCG
TCGAACGGTGGGCCAAGGGTAGCCATCTCGTACAGCAAACACCCCAGCGCCCAAATGTCCGAGCGGTCGTCGTATGTCATCTCGTTCACCATCTCTGGGC
TCATGTAGTACGGCGTTCCCACGTTCGTTTGAGCGAAGCGAGACTCACTGCTCAGCTCCTTGGCGAGACCGAAGTCACCAAGCTTCGCATTGTTCTGTAG
AaagtaaaataaaataaaatcTGTCAGAAACCTATAGATACCAAAAAAAGACAAGGAAAACTGCAAAAAAAACTTCGTACGTTGGAGTCTAGGAAAATGT
TGCCTGGCTTGATGTCACGGTGGAGAATGGGGCGGATAACGTTGCCTTCGCGGTGACGGTGACACTCCTTCAGTGCCAGGAAGATGTGCGTGAAAATGTG
CCAGATGAAGCCCTCTTCGATGTAGGACCTGCCGACAAAAAAGAATTAAAAAAAGAAAAGAAGGAAAAGTCAGGAATCCACTGAAATGATACAAGATGCT
GTGCTCTTGGGATCGGCATAGTGAGTGGCGTACCCCTCtcgtttcttcctcttgaTGAACTGGCCAAGGTCACCGCCTTCACAGAACTCCATGACGATGT
AGATCTTGGTCGCCTGCTTGTCGATCACTCGGTCCAAGTAGCGGACGATGTGCGGGTGGCGTAGCTCCCTCAAGATGTTCACCTGCACAAGAAAGAATCC
CCCATAATAACGTTAGCATAGTCAGTCGCCCAACGGAGGTATTATACGTCCGCCGTCGACGGACCTCGCTGAcgatgagctgcttctccttctcgctcat
CGCGCCGTAGTTGACTTCCTTCCACACGAGCATCTACTCGCCATCATACACACGTCAGTATTAAATCCTTCGGCATGTGTCCCCCTGAGTGTCACTGCTC
TCACCTTGCGGTCGGCTTTGCGCACGATCTGCGTGACGACGCCGAAGGAGCCCTTGCCGATGATGCGGACCTGCTCGTACGCGTCCATGGTGGCTGCtag
atgctgctgtggctgcggGGAAGGAGGATGGGATCTCCACGTAGACGGAGGGATGTAGGGAGGGGTGCGTTGTGTGCCTGGTAACGCGAGAGAACGAGAT
CGAGGCGATGAAAGAGCGACTGTCTGAGTGACCGATCGCCCTCCGagcgctgcgtcttcttctctcaACTGTTCTTCGTTT