Description :
From Genome Similarity Track
Location :
Scaffold_706:4173- 5354
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_706-fgenesh-gene-0.1NudC domain containing 1

Sequence
1181 bases(100 bases per row)
GCAAATCTAGCATCCCGTACAGTTCGCTAGACGAGCCCTTGCACAGCACTTCTGAAGAAGCGGTCCGAAGCCCCACGAGCAGCCACGCACGGGAAGGCCC
GCTCGAAGTGCCTACGCCAGACACCATTCTCGGGGGATTTGAAGAGTGCGACGACCTCGACCCGAATGCCACGGCCGTGCTTTTGCTCATTGACACCAAA
CAACAAGTCGTCCAGGACAAGCTCGACATCAACTGCCGCAGCTTCCGGTACCTCGGCCGGAGTGCCTCCCGCACCGACAGCAGCGGCGTTCCTTTCGATA
CGTCCTTGCTCTTCCAGAACGACGTCCACGGACTCGTGTTTGAGGTTGCAGCAACCGCGACGCGTCTATCTTTACGCCACACCGCCACGTTCCCAGCGTT
TGGCTTCGTACAGGCCTCCAAGCAAGACAAGAAGTATCTGACGTACGACGCCCAAGCACGCTTCGCCACGATTGGCGAGTTTGAGAAGCGACTGTTCGTG
TACCACGGCGAGCATGCCAGTGCACAAGAGAAAGACGCCCATGTGCGCAAGCAGAATGTCGTCGAGATTGGCGACCATCAGCTGATGGGCATGTGTGGGG
TCGGTGCTGCGATCTTGCTCCTCAGCCCGCACCACATTTACCATGTCAGCGTCGCTTCGTCCACGAGTTAGCTTAGCTCTTTGAATTGGCCCCCTATTCG
GGATCCCTTTTTATAGGAATTATAGCCAATGCGAACGTAGTATTTGGAGATGCATGCTTTTGATTGGGTAAATATTTGATCACCAAGAGTGTTGGTGGCA
CTAAACCGAGGTTTTTGTGCCTGTTGTTGGTGGATGTCATTCCANNNNNNNNNNTCAAGAGTGTTGGTGGCACTAAAGCGAGGTTTTCGTGCCGGTTGTT
GGTGGACGTCATTCCAGAGCCGCTCACCACCACAGCGCCGCTCGACTTTTTCTGCGACGACGACCATGACGCTCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCTGCAGCCCGCGACGCTGGCCGCCGCCAGGACGCTCGGCAAGGGGTACGTATTCCCATTGGTGGTGATTGTGCAGCCTCTGTTGGG
GGTGGAACTCTAACTTACGGAACGATCTCTTGGTGGTAGGAACCGCACCCCGTTCCAAAGCCATGTGCTGAGATTCGACGG