Description :
From Genome Similarity Track
Location :
Scaffold_19:417241- 422917
Transcript NameFunction/comments
Physo_132139reverse transcriptase

Sequence
5676 bases(100 bases per row)
ACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAAAGCAGCATCTTT
TAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCATAGAATATTACATTTAGAGGAAGTCAGAAAGCATAA
AACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGACGGTTTATTCAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAGTTT
AAACTAAGCTACGCTTCCTCACACACATACGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACCTGGTAGCAGTTGTTGGTCCATCC
AACGACCGACTACCTGAGTTCGTACGTCACCACACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTTG
CACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGCGGGAGGCCCTGCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCCACGATGCTGCGTGC
GCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCACGGTGTCGTCCGGGACGACACCA
CGCGCGCAATCGCTGAAGCTCAATGTGAGTAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACAGCCATTGCGGCTC
GACGTAACGTTGACCCGTTGTCGAAGGTGGCGTTCGCCATGTCATGCTTTGGCGGACGCGCAAGAAGTTGGGCGCATAAACGCCGACTCTCGGATCCTAC
GCGCTTTAGCACATACGAGAGTTTCAAGGATAAGCTCAGACGAGCGTTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAG
CAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCGATCCGATCGACGAGGCGGCCAAGGTCGTCACGT
TCATGAAGGGACTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAGGAGGAGTT
TAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGCCACGCCCGGTAGTGAGGACGGGAGCCCAGAACCCATGGAGCTCTAGAGTGCTGCAACTGCTG
GACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACTGTTGCTGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCCCCCATGCACCAGCAGGGTGG
CTATCGCGGCGGTGCCGGGCACCGTCAGTAGGCGCGGGGCGCCCAACTGGTAATGCAGTTCCGCGTGACGACCTTGGACACGCGACACTAAGGACTGCAG
CCCCCAGTGAGATTTATTCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTGTCATCCTGAACGTGAAGTCGATGAGAGCAAGCGGCTCTCTCCGTGC
TTTGGTAGATTCTGGCGCGTCGAAAAACTTTGTTCGACTGCGCAGTCTATCAAGGCTTGACTTCGAGGATTTTAAGATATTTCGAAGTATGTTGGAGGTA
CGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGACCAAGAGTTTGTCGAGACCTTTATCGTCCTGG
ATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGTTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCACACTCTCGTGCGCTTCGGTCG
CGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAGCAGCAAGCGTCGGCGTCGCCG
CCGACAGCTGAAGGAGAAAATGTGTTGATTTCGGAGATCGACACCCGCTTTTCAGCGAATCAGGAAGAGCCTCCGGTCTCAAGGGGCACGGATGATGCAG
GCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCCAAGGTGACTTAATGCCGTCGACTCCGGG
AGTCGATGACTTGGACGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGAGCTCCGCCAATAACAGGCATCGAGGTAAGGATGGC
GTGTCGACTCCGGGAGTCGACACTGCAAGTGGTGCGGACGGTTGCAAGCGTCCCGCATGCATGGTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGC
GACCAAGCCGGGCTTGAAGTCGCTCGTCCGCGGGATGAACACGCCGGCGGGACTGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAA
GCGGAGCCGGGCTCCGCAAAGCAAGACGACGGCGCATGCGAAGGTCACTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGAAATGTCTGCCGGGCA
GACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGGTCCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACG
CAAGCGTCGGAGTTGACTTCACTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACG
CCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGCCAGTTCTTCATGGAGACCACCACTGAGAGCGAGGACACTCTCAGTGCAAAGACGAAGAAGGAGCG
CTTTGAAGAACAGAGCTGGGGCTCGTTGAAAACGAGTCCCTACTACACGATCTTACGGGAGTACGCGGACGTACTTCCGGAAGAGATCCCTGCTGAGCTT
CCCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTCT
TTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAGTCCGCACACAGTTCTCCGACATTCTGTGTCAAGAAGCCACAGGGCGGCGGGCGCATCGT
CCATGCGTACAACAAGTTGAACGATGCGACGATACCGGCGCAGACACCGATACAGCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTAC
AGTGCTCTTGATCTGCACGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCAGTGAGCACGCCGAGTGGCATGCTCTGGGAGT
GGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGATGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGAC
GATGTGTTCATCCACAGCCGGGCCGCGGACGAGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGGAAGCACAAGC
TCTATGCGAACCTAAAGAAGTGCATTTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGT
CAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCG
GGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGC
CTGAGGCGCCGAGCTTGGCGGTGGCCGACCAAGATCACCCATTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCCCAA
TCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGTAGCTCCTTGCCATGAAG
TACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGTTGCGGACGGCTGTGAAGTCGCCGCACA
TCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGACGACGCGCTCTC
GCGTCGACCTGACTACGCCACGACTGATGCTGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGTTGGACGACGTGAAGGTC
GCGTTCGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTG
CACACCGTTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGTCCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAG
GATCATGTATGAGTATCACGATGCACCGACTACGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCCCGCGAGACTTCTACTGGACCCACCAGTAT
AAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTGCCGACTCCGTCGG
AGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCTGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGTAAGAT
GGTACATCTTTTTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATT
GTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTATACTTCCTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGA
CGGACGAGCAGACCGAGCACGTGAACTGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACAGTGGAGCGAGTGCCTGCCGATGGCGGA
GTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCACGCACCCACGCCTCCCGAGTCTACTCGGGATGGTG
GCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGAAGA
AGAAGTAACACGCGTCTGTGCAGGGCACAGACGCCGACTACGCGCAAGAAGAAGAAGAAAAAGAAGAACGGGTATGTACAGAGCACAGACACCGCGAAGA
CGAACGCAGAGGCCGGGCCTAGTGCTGGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCGTTCGATTTGT
CCAAGACGCTATTGCAGCTTCTGTTGATCGATAGAAGCTGAACGCAGACAACGTTGGCAGGGGCAACACAAATGAA