Description :
From Genome Similarity Track
Location :
Scaffold_208:41722- 47010
Transcript NameFunction/comments
Hyaar_Emoy2812623hypothetical protein
Hyaar_Emoy2812624hypothetical protein

Sequence
5288 bases(100 bases per row)
CTCGAGGATCGCTTGCATGTAGAAAGAGCTCTGGATTTATATTGTTGCTGTGGTAGTGAAACCCTCGACTTTGCTGTTGACGTATAATCTAACAACGGCA
TATGATGAGTTCCTGTAATCCTACAGCTGCTGCTTCTTCCCTGACTACTTCCCTGAAGACATGTATTTCCTGCCGGCTTCTACTTTCTTAGCCCCTATCC
ATACGGTCGTGTTTTGTACTACAACTATGCTGCATATGCTACAGGTTAGCTAATGCGCTTCACGAATCACTCCCCACGGGACTTCTATTACTGCAGACGC
TTCCAGGACCTTCAATTATACTACAGTAACGTTATATTCTCACCGCTTCAAGCCCGCTACAATTGCAAATTATTGCGATTCATTATTTTCAGTAGTAACA
TCGACTTTCGCTTGAAGTTGTCCGATGACCGCTTATCATACTGTTACGACCGTATATATACCTGGCTTTTTCGCAGCAGGTGCACCATAACGCTCGCCAA
CGTTTTAATCTCCTTATAGCGCGACGACACCCTATTTTTGAGGGAAAAGTTTGCGCAAATTTGGTACAGAGGAACGGACCCAAGTCCACAGTTGCTAGCT
GCTACAATGCCGTCGATGGTGCATTACCGTCTGCAAGCCAACGCTTTGTCCTGCATCGAGACACCAGCGATACCTTTACTAACGCATCGTGCAAGGAATG
CCCAACTGTAACACCTCCGCTTTCGACGCTCGGTGGAAAATGGAAGGTCGGTCCGCACGAAGCTGTACATTTGACGGGCCGTTACGTTCGATGTGACGAC
AAATCGATGATTCCAGAAACCAATAAAGAGAAATAAGGGCGCGATGTTTACGAACTCGATCTAGATGGTGTTCTTCTGTTTGCATCGAGCTAAATCCACT
GAGCTAGTCACGAATTGGACCAAAACAAGGTCCACACTATCGAACTATTTGCAACATCGTGTTGGTCACCGACCGGAAAAGGATCACATGGTGTGGTGAC
TTCGAAAGCATTCTCGTAGAGTCAACTCATAACGCGCGCTTAAGTCTTCGAGTCAAAAAGTTTCGCGCTGTTTCGACAGGCTGTCCGTACGTTTCGTGTG
TTCTAGAAACTCTATGAGATTCTAAAAATCGTACCAGATGGTAGTGAATATACTATCAAGCTGTTATGTTGCGCGTATCAGATTTGGGACATTAATTGTA
AATGGTGTTCGAGTGCGTACACGTTTTCATTTAAGTATACTTACGTCACAGCCGCCCGTTCGCCATCGCGAACTAACGATTGACGTGTTTATTTGAATAC
GTGCGATGCTCGGCCTTGTGCCACTATCTAATTTCTTCGAATCATTAACCGGATACACTATGTACAGACAGTATCCTCAATCCATAGACTGCTCATCAAG
TCGTCGCTCGCGATAAAATCGAACCCGCGTCGTACATGATGACCATGCCTGCTATCATGCCTAAATGCAACAAATGCGTAGCTAATGCGCTGCAAGCTCA
GAGGAATTTCGATCTTAGCATGCCCATTCCGATACAGAACACTCGTTATGGACTGATAGTCCCGCCGTAAAAGAGAGCAGTAGCCTATGCACAATAAACC
TTTCCACGCTCCCCGCCTTTTGTTGAGAAAGTTGTACCTTCACGATCTCGTAAGATTTCGACAATGTAGCAAAGGCCTGACGCGCCTTTGTAGACTTGGA
CCAGATCCTTCCAAACGCTTTGCCTATCAGAAATCTGCCCATATCACAGACGGTGGCCAAAATTTCCAGAGCGAGGACACGGGGCCTAGGTTCAATCTCG
TCGTGTTCTAGTCCGAAGACGTTGTTTAAGGCCCGGTCAAAAACGTTCCGCATACTATAAGGACAGACGCCCAAATCTAGAGACTGCTATGTGGCGAGCG
GAGCATTGCCAGCCTTTATCGAAACGTAAAATAAAACTGTGCACGTTCAGTCTAGGACTGTACTTAATGCTTGTACTCCTTGAGTGCTGGTGGCAACAGG
AGGTATTGTCAACGATATTTAAATAAGTCCAACCAACACGTGAAGCATTGACACACAAACCACTTGATGTTGATCGATTATGCCCACAAACTCCCCTGTA
TATTTTACCGAAACGTGCGCAAACTGACTCGTTTTCCACGAATCAGCTCGAAATTCTCCGTGCACGTCACACACCCTCACTCACTTTTTGGCCATGTCTA
TACAAACCGCAAGATCCTTCCTCGCTCGCGCAACAAGAACCTCGTCCGTCCTTTCTGCCAGCTTTTCCGATCAGTTAATAAAGTCGGTCCGTCAGACGAG
GCCCAAACGTGTCTCACGTATACAGATAGAACCCTTCAGCAAGCGGTTAGGGCCCTCACCTGCACCTCGTCTGCCCCTTCTGCCGCCTCCCTTTTACAAG
ACCTCTTCCTCTTCCCCAGCAGCTCATTCTTCTATTTGCTCCCTCGCCTCTACCTGCACTGAACCTTTTGACTCGTTTTTGTCCATTATCTGCCTTCATG
GTCTCTTTTTATCCGTTCGTTCTGCTCGCCCTCAGTGCGAAGCTCACGACCGCCGATACCGTCGACAACGATGAAGGCGGCAGCCTCATGATGGCCGTTG
GCACGAACGGCGCGACCGTGGCCGCCACCCGTGGCACCACTTCCTTCATGAACACCGAGTACAATCCCGATCGGTGCGTGCTCCAGTTCCTGAGTCTCGA
GTGCGACGACGAGAGCTGTGGCGAACTGAATGGGTTCAAGCTCGAGTGTGTCTCGAAAGGGCTGCAAAACGGCCGTGAGAAGAAGATGTGCGAGTGCCAA
GCGGCCGACTCGCAAAAGTGCCAGAACTCGGTGAGTCCTAACGCCACGTCGGGCACAGTCGCTCAATTTGGCGAGTGCAGTGACCAGCTCCGGTGTGTCG
ACTCTTATGGCTACATTGCCACGTCTCAGGAAGAAGGGCCCGTCTGTGCCGAACGGTTGCACTGTCTGCAGGAAATTAATTCGAAGGCCACGGCTCCGGC
TTCTATTTGCCACACGTGCATGTCGTGCATTGCACAGAATGACGCGGCCGAGAAACAGTTGGCGGCTGCCAAGCGCTTTAACTGCTCGGCCATTTGTCCG
CAGGAGATTCTCGAGACGGTAGCCGAGCGTAATGCGGCCGGAGTGGGCATTGCCGACTCGTACACGGTCATGGGCTCAGCCAGTGGCTCAGCTGCAGAAG
GTAGTTCAACGGTGCCGGATAGCACGACGGACGTGCAGGACACGAGCGCGTCGTCAATGGTCAAGCCACAAACCAAGATGGGGGTCATGGTGTCGGTGAT
TGTTGCAGCGGTGCTGGTGGCTGTGATGAACTAGGTAGGAGGAGGAAGAAGTTAGACGGGAGGAAACTGCTTGCAATTCCTGGTATTTACGTTATCAACC
ATTACTACTGCAATTGCGATACTTAAGGATGTGGCTGTCGTTGCAGGTGCGCTTGGTTGCTATACGTAATAAAAAGACAACGATTACTTACATACTATAA
CGCAAGCATGTGCCACCCACCTACGTACACTGGTGCAATGCAAGTAGAATAGAGAAATAGAGAAATAGAGACAGAGAGACAGCGCATTTACTTCACATAA
GGACTGGATCCCTCCTACAAGTAGAGCGCCTTCAGCCGACTAGTAATGTCATTAAAGACGGTCCCTCGTGCGTTCAAACTCTGCAGCTTGCAATCCGATG
CGTCGAGCTACTGCCCGTCGAATCTTCTCCACTTCGGGTGGTTCCGTGGCTCCATTTAAATGCTTGGGTTTGGGTAAAGGACAATAGGCCTTAGTAGAGA
CATGACGAACAGAGAGCAAGCCTGTGCCAATCTCACGGCGAACGACGTTCGCTCCGCATACGTTACGACGAATGGCCTTTCGATCGGTAGAATCTGCTGG
AATCGGATGCAGCGAGTCATCGTCCACATAGTCCCAGAAGATGATCCCTTCATCCCGACCGCACTGCTCACGAGTCCGGACACGAGCCTCAACGTCAATA
TTTTCAACGCTATCGGCATCATCGACCACCTCAAACACGGGCTCCATTAAAGCTGCTAGATTCGAGTAGTACACACACGCGTTCGTCATGCCGTCGTCTT
CCACAAGTTGCACATCGTCCGCTGCCCGAGCTTCATAAGATACTCCAGAGTAGTACATGCCAATGGATTTCATAGTTAGGGAGGCGATATCCATAAGGGT
GTACAACGTACACTTGTCAGTCTCCGGATAAAAGAACACGGACGAAAATTCTTTAATCACACGACCGTCTCCTGCATCATCCACACTCGAACTCGAAGGG
TCGTTACTACTGCCGTTTGGTCGTCCGAATACTCCCGCATCATCACGTTCGCGAGTGCCGTCGTGCAAAATCCGGACACTCCCGGAAAACATTTGACGTG
TCGCTAGTAATCGCTGCGCCTCGTCCTCCGTGTTGCGTATCACAATGTTTTTCGCCAGCTCCATCTTGCTCCGTGGAAAGTGAGCCACATACTCCTTCCT
GCGCACGAGTGTATCAGATGCTGACAAGGCCGTGTACGAGTGCACCCAGTCATGGAACTCGAGCGTCTTGGAAAGCAGCAAATTGCTGCCTCCCATCATA
GCCTTCATCCCTCCAAGAAACATCGTCTGCTGGAACAGGGCGTGTTTGAGCATTTGATTGTTCTGCTCAGCCTGCTTCCTTTTACGCCGTTGCGTCATCA
CTTCCTCCTCGTACGCCACGAGCTCATCACTATTAGCCAATTGAGCTCGTCTCGCAGCTCGAAGTGTAGCCAGTTTAGTCGTCAGTTGAGTCATCTCCAC
CTGCAATGAAGACACGAGACACTTCTTCTTCTCCCGATGACGCTGTACACCCGTTGCAATTTGCGACCTTCGTCGCTGCTTCTTCTGCTCTTCAGGGCTC
CCTGCAGACGTTTTGGGGGCTGTCGTTGACACAGTTGTCTTGCGCCCTCGTTTTCTACACACTTTCTTCAATCCTTCTGCATTTTCAAGTTTTTCAGGAC
TACAGTGACTCGAACAGGTTCGTCTTCGACTCCAAAAGAGCTCCTTGATTAGTTGGAATCAATTGAAAGGGCCCCCGAGAACGGAGACGAAGACGTGGCC
TCGCTTTGAGGAAATTGGGGGTCATTTATCGTATCCTGAGTCATAAACGCTAACATGTGGCCCAGATCGATCGCCGAAGGTGGTGGCAAGGAACATAGTG
CGTCGTTAATGAGGATATCGCTCAGACAGTCCTAATCCTGGTCCAAACTCGCAGTGGGAGCTCAGCCATTGGGTCATCGCTTAGAACA