Description :
From Genome Similarity Track
Location :
Scaffold_226:4172- 30391
Transcript NameFunction/comments
Phyag_g3693hypothetical protein
Phyag_g3694conserved hypothetical protein
Phyag_g3695hypothetical protein
Phyag_g3696hypothetical protein
Phyag_g3697hypothetical protein PHYSODRAFT_293856

Sequence
26219 bases(100 bases per row)
TtcaagagaagcagcaattggcgtCAAAGGCCTAGTAGACGTCGCGGCCGCTTTTTTGCCATTCGGAATGACCTTCTTCGTAGCTTTAGATGACACATCC
TTCGCATTCTTCTGTGCAACACCCCCTTGTGCAGTACCAACGTTGCCACGCACTTGCTTCTCTGGCTCCTCCGATAAAACTAGTGGTTTTCCTTGTCGAG
GGTGTGCAACAGCGCGCGTTTTGGGCGATGCACTCCTAACCTTTGGAGACTTTTTCCACTTTTTGCGAGAACCTGGCGATTTAGGTGACGGTGCCGCTGA
GATGTTACTAGTTCCCACAGAGCTCACGGTCTTTGTCTCCGTCGAATCGTCGGCCACTTTTACTTGGGCTGCAGGTGGCCCAGAACTGCCTCCAATCGCT
GCCAGGCTTGCAGACGCAGTATTATCATCGTTGCTCTCCGCTGCCGCCTGATCATGTGACTTTTtctttcccttcttcttTCTTTTTTTTCTGGCCAAGC
GCTTCTCAGCTGGTCCATCGGTAGGGTCGCCTttatttgctgctgtgttcATAGCATTCTTCTCCTCAACACTTTCCACCacttccttcagcttctcttc
CTTCGGTACAGCAGCCGCTGGGCTCGATGGCGTTTTGTGTTTCTTACGCGGTGGTTTTGCACCTTGTTTCATCGCGATCTCCTTCATGCTTCCCAGCGCT
TGTTCCAATGGATCCACACCATCatcgccacctccttcctcctccccTTTATTCATTGAATGCCATTGCGGAGCCTGAGCAGCAACCGTCTGCACctgcg
tcgtcatcttcactgTTTGCAATGCAGCACTCTTCTTCCCCTTCTGCTCCACGTGAACTacactcttcttcttctgtgtgctcttcttggcacTCAACAT
CCCAGGAACCTTCACGACCGCCGGTCCAGtcactttcttctcctcctgctgcactTTCACCTCTatcttcttgtttttcttgtttttctcCTTCATTGCC
TTGCTGGTGTTGAATTTCACCATTGGAACGGGCTttccgtcgtctccatccgCAGATTTCTttttgtgcttcttgttttTAGTCTTGAACAGCACTCGGG
GCGTCTCTGGAGCTGCAACTGCCGCTTCTTCCTGCGGCAACTCGAACATCCGCGCGTGGAAAGCTGCCAATCGCTTGCgcgcgtcgtcatcgccaccCTG
TTCGGCCTGGAAGCTCTCGGAGCGGCGCCGCTTCTTGGTGCCCATTTTCACAAAGTGGGCTATTGGTTGATGGCCCGTTACGTCAGGACCAGCAgatttt
ccaccaatcaaaatAATCAAAACTATTTATACCGGCCAATCACATAGCAAAAAAAGCGACTATTGTTTGGCGATATGAGACCATCGCTTGTAGCGATTGG
GGtcgtagttgctgctgtggggGTGTATGGCTACTACCATGGTCTACTTTCCACTCACCAGCGTGGAAAAACTACCAGACAATGTCGTCGCGAAATGTTG
CGGTCGAACCGTCGCAATCGCAAGGATGAACGCCTGAAGTCCAAGAAAGTCGCTCGTAGCCAAGCGTTGGCAGTCGAACGGGCCGAAAtgacggaggaag
agaagaacgagaagcgAGAACGGATTCGCATGCAACGGGTGGAGCAATATGTACGTTTCTGCCGTTAGAACTGGGTTTCTAGTTGCAGCTGTGGGGGCTG
ATTTTGTTGGTCGAGTAGCAAAAACTGGAGGAAGCTCAGTTGAGTGGCATCCGGGTGGTGGTAGACTTGGCCTTTGCAACCAAGCAAACTACGCGAGTGA
GTTGTTATGTGGTATTTAATTAAGTAaaatgttgcagcaactcaTGATACGTTTTTGTTTGTCGCTGTAGGAGTGTCACAGCATTTTCAAGCAGCTTGGG
TGTGTGTATGGGTATCTGAAGACGTGTCCATTGGATCAACTGTTTTCACTGCATCTCGCCTCTTGTACGCAAGATTTGGCAGTAATCTATGCACGACATG
GTGTATTGAGCTGGAAGGTATGCCCAGCTTGCTTCTGCTTTACTGGTGGTGTTCTTGCTGATAGCTATTATCGTACCAGATCGGCAGGCATGAGGAACCC
TTTGAGCAGCTTTATGCCGCTGATCAGCTTGTTTACCTGTCGCCAGATTCGGATAATGTtctcgaccaactcgacccAACCTGTGTGTATGTCGTCGGTG
GCATCGTTGATCGCTCCGTCCGCAAGGTAATTTCGAGTCATGTGCGTTGTTCTCGTTAACAACTTTAACAAACTCTGGGTCTGAATACTCAAAAAGGGCG
AGACAAAAGCGaaagcagcttcacgtgGTATTCGAACTGCACGGTTGCCACTCCACGAGCACTTTCAGCAGTCAGGAGGACGTGTTCGAACTCACATCAT
GAACCTCGACTCGGTTCTTATTGTGCTGAATGAAGTGGCGAACCACGGAGACTGGGGACGAGCATTCCAGCGAACAGTACCTCCACGCATCACCCGAAGC
AAAGGGTCTCAGAAGAAACTTACCAATGCGGAGACCAAGGTGGCTGCCGAAGCAACTTAGTTCACAAATGGAATAGAAAACATGAATGCATATTTCATAT
CAATCCTACGGCTAATCTTCACTCGCCCGTAATCGTGGACATGCCGGCAATGACACTAGAGActgcggcggctgcagttgcagtagcagtggcagcagta
TTGGTCCAGTTAATGCCTTGGCCGGCTCGTTGGGCTACAGTCGTGTTGTCTGCATCAATGGACTGGCAGTGAGTGATAGCATACACGAGTTTGTCGCGCA
TGACGTCACGGCACGAGTAGGCTGGCAAGTCGATCGAAAAGAAACCTACAAAATATTGAAACGGTTCAGTCTATCGATGCTGGGCAAGTCGTGACACAAC
AAACTTACAGGTATGTGCAATAGGCAGGTACATATCGGCACGACCCGCAGCCTTGGGCAATCCTGAGATTTTGAAGTCCTGCGTGAAATCTGCAGCGTGT
GTTGGCAGACGCGATCGACCCCTGCAGCCCAACACAATTTTCAACATTAGAACAAGCTACCACCACAAACTACTATGCTCTGGTGTTGACATACCAGACG
AAGCGCAGGAAAGACGATTTCTGCTCGTCACTGAATTCTCCCAGGACCTCCCAGAAGTAGCCGATGTGAGAGTCTGTTGCCTGACAGCCGTCCCCGTAAA
TTGTGCGCCGTCGCAGTAGAGAAATATCGACTGTAGCTTTACCACACACGAGAGTCCGCAGCTCATGCCACGTGAAAAGACCAAGGGTAGGTGCCGGTAG
AATAGTCGCCAAACCTCGAGACATATCTCCACACACTGGTGCAAATTCAGTTAAGCGATACGTCTCGACAGCGCACGCATATTCCTCTCGATCATCCCAT
GTCACGTGCAAATTTCTTCCACCAGGGACTAATTCCACTGTCTCACGCGTGCTTGACAACACCGTGAAACTTGCGTCCACAATTTCGTCAAACATCGATT
CAGTGATGCCATGAGCATCAAGGTTAGAAATAGTGTTCACAACCTGGAAGCAACCTTGATGAATGGCTTCAATATCGTTTCGTGTCACGCGTTGCCCCAC
CAGCAATTTCCACACGACCGGAGGGAGATTTAAGTCTAGCGGTGTTTTGGTCCGTACAGCGATACCCGCGAGTTTTCCCAGGTACTCGGCCATTTGTACG
CGTCGAGGGTTTGTTCGCAGGTGCGAGTTTGGCACGAACAACTCACGGTTTTCACCTGTATTCATCAGGGCGTTCGGGCAAGGCCTGAACACAGGCAGCA
ATGGCGTGAAGGTCTGCAGCTCAGAACTTAGTTGCGCCAAACATTCGCGGTATAAACCTCCAAAATCATCACCGAACTCGCCCACGAACTGGCACTTAAA
TGCACGATCAGCTCCACGTAGCAGTGCTGGTTGCAGCCCATGTAGCTGCTCGAAAGTCTGAGCAAATACACTATCTCGCTCGCCAGCCTCACCTGCAAGA
GGGTCGCCATGCTCAGAAAGCTCAAGTGCATCATGAGCGCGATGACGATCGACCTCAATCTctggacgagcagcagctggtgcCTGCTGTTCTTTAAGGA
CGCCGAGCCACCACGCAAGCTTCACATGTTGGAAGACCACGCCACGAAGCGCCCTTGCACCACGTGCTAGCAGTGAGCGTTCATCTTGCGCCGAAAAGTC
GATGAAAGCAAGTGAGGTTTGCAATcggcagttgaagttgcgtAACACCAGGAAGCGGCGTTGGATTGCTTCGAGAGGAATACCTCGCAGTACGGGGAAT
CCATGGATCTGCTCTTCGGTTGGGGCAAATTCCTCAGGAGTCATGCGGAGTGGATCGCAGCTTAGCAATGCTTCAGCACGTGACTCACATATCTCATTta
cgagctgtacgagaGCACGATCGCAAGCTGGAGTAAATACACTTTGTGATGCGTGCAGACGACGCAGTTTGGTGCCATACTTGGTTGCCAATAGACGACG
CCCAGTTACAGAGAATTCTGGCACAGCGGTGAACGCTACACCCCACTTGGTATCTCCGACAgactgctgcggctgtggcTGCGTCGACACGTCATCTGTG
GTTACCTCTTCTGCGGAtcgaacggcgtcgacgtctccatcaaCAGGGGTTGAGGCATTTAATTCGTCACTTTCCACGTTATCAGCCAGGGCTAACGCct
gttcatgcagcagctgacgaTGACGTGCACGGCGCGCCATTGcctcagcttcttcacgaacaAGTCCTTCCATCGCGTGCATGTTGGCAAGAATAAAGTC
TGCCGCCTGCTCAGCCTCATCTTCGCAGTGACGTAGAGCGTAGATACACCACTCCATAGGGAACCCCATTTGGCTAAGCGCAATACTCAACTCCATGCGG
AAGTTTGGAATGGCTTCGTCACCTGCGCCTCCTTCGCCGCCTCCGAATCCGCCcaggtcttcttcttcctcactGTAGTACGAGTCCTCTCCACTCGCCA
GTCCGCTTCCTGTTCGAAGCAAGCCTGGCTCATGTCCTCCGTCCTCAACGCGATGTCCACCGATAAGATCAATCGAGTCTCGTTGGTTATACAATGCAAA
TGCTGGGTAAAAGGTGCCCTCAAGCTTAGGTCCAGTCCCACCCGGACCGAAGGCGACGCCCAAGTCCTTGCCATTGAGAGCATAACTGAGTGTGCCTCGA
CGCAGGTCCAGTGTGAGGCGAACAATATCTCCCGTCTTAAACTTGTCGCCATAAGTGCCACGCTGTTTGCTGCCATTGTGCCATAGTGCACGATTGCCGA
TCCAGCCCCATCCGCGGTTATCCTTTCCTAAATAGGAGTCCAACCGAACGTCTCGGCGACCGATACCCAAAAAGATGTTTGAGCTTGCAGTCACGAACGT
GATACGAACTTCCCAAATGTACACTCCTCCATCGAAGCGCGCTACACCGATAGCTGTTTGCCAGCCCTTGTCACGCACAAGTGACAACCGTGTGTCTCGT
GCCTCAAGTTTAAGATATGGTCCTTTGCGTACGCGATCGACGCGGCATTGGAAATTCGACTGCACCGGGAAGCGCCACACAAAGCTATCGCCATCTATAG
TGACCTCCTGCCCGCCGCAAGCACCAGTAAACGCTCGtacttcagcttcacctcctccactcGTCGTATTTTCAGTTCCACCTTCAGTACCGGCAGTATT
TCCACCTTGGAGAATCTGCAGGCAGTGAGAATTGGCCGTCTCGCTTTGAGCAGATAATCGCACACGAATACTCGTAGCTAACGGGATGCTAACGAGTGAT
TCTTGTAGCTCAAGATCATACGGGTGTGAGCTCTCCACTCGAATACAGACATCCTCCGAGATCTCTGACAAGAAATTATCAGCTGAAAGCATGAATTCAT
CAGGCAGTTGAGCTACAACAGCAGTGTCGCTCGTTTCATCAAACGTTTTCTCAGGAGCATTCACTTCTTCAGACCTTGCAGGGTCCATTAGCGCCTTCAT
CACACCGTAAACCTGGCTAAGGGGTTCGAACCACTCGAAGGCACTCATTAGGTTGTCACAATCAAGCGAGTGGAacctgaagctgaagttAGCGTGCTTG
GTTGATGTTGTAGCCGTAGCTCCCAGGTTGGCGAGAAGTTTGCAATCCGCATTAAAGGAAATGGTCGGATGCAACTGGTGAGGGCGTGAGATGTTCGAGA
ACGCGGTGCCTAACAGTTGGCCATTCTTGCAGAAAAAAATCTCTTGTGTGTCTAGGCGTAAACCACAGCCGAACACATCGCCAAGGCTCACAGCACCTGC
GGGCTCCACCCATCGCCAACGATCCACAGCATTATCACCGGCACACAACACTTGGCCGTTCGCAGGGATGAAAGCGTAAGATCGTGAGCCGTCCGCGCTA
CCGCCTACAAGCACTCCTTCCAGCGGgaatggtggtggtgaaaacCCGAGCACTAGCGAACCTCCCATGTTAGAACTAGTATTCCATTCCATGACTGTGA
CTTCAAAGTAGACGATTTCAGCTTTCACCTCGTCTCGCATGGTCATCACGAGAGCAGGGGTGTGCTCGAAACGACAAGAGTATACATCTCCAGGGGGTGC
GCCaagtccttcttctcgtgcagCAACGTTAccgccatcttcagctcgatAGTCTAGTAAGAATTTGCGCTCTTCACCCGACAGGTGCCGAGTTACTGCC
ATCTTGGACGAGTGGCTCACCAACATTTCCACGAAAGGCTGCTTGGAAAAGTGGAATCGATAAGGTAGTCTGAGTGAGGTGCCACCGTCACCTTCTAAGC
AGGCAGCTAGCTCTTGCACTCGTCggttgcgctgctggtccTCGACTGCTAGCATTAATTCCACAAAAGCTTGTAGCAGCGCGTGCAACGTAAATCCACC
ATCCTGGTCTTGGCTCAAAGCCATGATCTTGGAGCGACAGTAAAGAAGAGCTTGCTTGTCATACCAGCGTGCACCTTGCTGAACCACCGTAATAAGCGCT
CGCACGAGTGATACTGCAGCTTGCCCACTTGAGGGTTGATTCTCACGTAGTACTTGTTGCACCAAAGCGAAGAGTGCAGCCGGTAGTTCAGGACGTAACA
GGGTAGTTTGCTTTACGTGCTCTTTGCTACGTAGCAACCGCtgatactgcagcagcacctcgaggaAGGAGAGGACATTGTCCACACTAACTGGTGCGCA
TAGAACGAGATCTTCGTCGGAGAGGTTCAGAGCAAACGCGGTGCCTGGTTCGCTAGCACTAGCGTCGTTGACTGTAACCACAGGTAGAAGGAGCCCACTG
CTAAAGTCCGCCTCAACCGCCCAAAGCGATGTCTGCACGACCATATCATCGGCAACAGGTAGCAAAAGCTGCATCCGGGACGTATCCGCTGCTTGGTTCT
TCACGGTACGACTCCGTGGAGTTTTCGGTTCATCCggagcttcatcttccatcTCAACTGTTGTAGGAAGCTCGACACCTCCGCCACCTGTCGAtgcagg
agatgcagcacGCCACACGCAGTGGAACGCCTTAACACGTTTCACGAGATCTTCACGGACGCATCGTGTGCTAGCCATGTCTGGGGGTTCAAATGGGTCT
TCCTTGCTTCCAGCTACGCAGCCTAGTGCCACGTATCCGGACGGCGCAACGGGCCACCAGATAGACCGCAGCTGTTTGCGTTGGAAATCGGGGTCGCTTT
CAGAATTTCTAGGCAAACCTTTTCCAGTGATGTCCACCCGTTCAAAACTGACAGGAGGCACCAAAAGCCCTTGGTTATCACTATCGCTGACAAGAATCAT
AGGGGTCTCTGGAGCACCGCTGCCGCATTTTACAACGTCACCCAAACAAAACCATTTATTGCCTGGCGGTGCGGATTCCAGTGCTGGGGGTACCATTGGA
CGCCAAATAGTCACAGCATAATCCGCTGCCGACTTCATCCATCCGTTATCATTGGCTGTAAACCGCTTCCGCCACTTGTGCCGGTGCTTGAGGAGAGGAT
CTGGTGGTGGAATACTCCACAAGCGCTCGAATGTATCGACCACCATGACTTCCAGACCACAAAAAAGCTGCATCGGCCCCTTCGGGAAACATCCATCTGC
CTTGCGAGCTCGAAGAGGTGAGCTTTCCCAGTTCGATGTTGCGACTGGCGCCGCGTGAGTCCGCGATAGAATTTGCAGGATCGTCTCGAACGTGACATTC
TCCAGCGTGTTGGGCTGATCCTGATCATTAACATCTTCCCCAGTACTGGTGTACTCACTATCGACGAGTGATTCAATTAGGCGAGTGATACCAGTCCAGC
CTACCTTAGTTGGATGCTCCGTCACCTGATCAATTGATCTCTGGATTGTGGATAAGTTCTGGGATGACGACAAATTCTCagccagcgtctgcgcggTGGA
GTGCGATATCACCTCAGCCGTCATACGCTTGAGGATCTGCTGAATTTTCCCGTTCTTTTGCGCGTTTGGTTGTTTGTGCAGTTGGTACTCCAACTCGGTA
GATGAATTTGCGCTGATTTTCCCCGATACGTTCAGAACCGAAATCAGCCGACGAAGAACCAGAGGGCTGCCAAGTTCACTGAGTGGTGCTTCCCCGTTGT
GTGATATATTTTTCGAAAGTCTGACAATCTGGAGCAGAATCTTTCGTGCGTGAATGGCGGCAAGACGCTCGCAAAGTACTTCTTCCTCGAGCTCGATCTC
GAATGCGTTCATCTGACGAACTCCTTCGTCAAAGCTGTTGCACTCAGTCCAAAGTGTCAAATTTGACTTCGGTTGTGTATCCACTGACACACTTCCGGCC
TTCTCCAACTTTTTTGTTTTAACGGGGCTGCCACTCGCCCTGGCTGCAAGTCGCGGAGGCATCGGAGGACACAATGCGCTAGACTCTGCGAGAGCGTAGC
TTGAATTTTCGTCACCGATATCTTGAAAGTTAACCAGCGGTTCACCAGCCGAGGTATCATCCTGCGGTGTGGTACTATCGAGACGCCTCGGAGCTATCAC
AGAACTCTCCAGCTCAGTCCCAGCACTTGACAGCAGTAAACGCAGTGCGTCGCCGTAATTGTTACGTGTTTGGCGCAGCGCTTCAGCGCACACGGCCTCA
GTTTTTCCAAGAACCATTGCCAAGTGACGCACATTTGCAGGATAGTTGTGCTGCGAAGCATTAGAAAGGTCCACGTGTTAATGTTAGTTGCAAAAAGAAG
TTAGCTTTAGCAAAACCACTTACCGAATCGAATCCGCGACTTTGTTGGATCATTGCGAATGCCTCATCCACATTACCAGCTACCATTCGAAGAGCTTCGT
CACAGTCAGCAGCACTAACATTTAAGTTTGCTTCTTGAACCCGAGCTAGTAGACGCAATGTTAGGCCTTGCGTCTCCTGGGAACCTGGTGATACATTCTG
GGCCATTTTCAATTACAATATAATGATTTAGAATCATCGCATCTCGTTTTACGGAGCAGTTAGTACAAACAAAGTGCAACTTACCGGAGATGTGGACAAG
CTGGCGGCACCGCTTGAGCGGAGGACACGTGTCTTAGCAAGTTCGCTTGAGAAATTCGACCGTTGTGACGGCGATTCGCGATTTACGCTGTCGCGACCAA
GTGCGATACGAAGCATTGACCCCACGCCGCCTTGGGGCGACGTTAAGCCTGTGGATTCATTCGGTGCAACACTTTCTCGTTGTTGGTAGGAAGCAGGAGA
AAGGAGGGCAGCTGGCACCATGGTTGAAAACATACTAGCACTTGGAGGCCTTACAGCTGGAGTACCTGGAGCTTGGAGCCGGGGAGAGGAATATCCACCA
GCTCTAGGGGAATCCACGGCAGGGTTCGGTGAGAGTAGTGCTCGCGGAACATCGCTCTCAGCAACAGATGTAATGACACGCAAGCCTTGTGTCGCTGCCT
GGCGACTTTGGCTAGCATTGAGGCCCTCTAATGTGGCAGAATTCCCACGGCCCCGATTTTGTAGTTCTGCTGGGCTTCTCGGTACGATCTGAGGCGTACC
AATCTGGGGTTGTTGGTACTCCTGCCCGGGGATCAAAATGTTTAAGTCACCTGGGTTTTGCGGTGTCGTGACAATAGGTGGTGGAGCGTGACGACCTCCA
GTACTGCCACCAGACGTCCGAACTTGAAATTCATAGGTGACCAGACCACCTCTGGACAATATTAACGAAATTCGTGATCCCGACGTGATTCGAGTGCTCG
ATCCATGAATCCTCACACCATTGACAATAGTGCCGTTCTTGCTAAAGTCCTGTAGCTCGAATTGTTCTTCAGCCCCCTGCGTTTCACGCCGCAAACGACG
CAAATGGAAGTGACGACCACTGACACTTCGGTCATTTACAATCAAATCACAAGCATCAGCAGCGCGACCCACTCGAACGATTGGCGCAGTAAGCGGAAAC
GGCGTGTTGTCAATGGCTGCATGCGCTGCACCTGCCGGCTGACCTTGCTCATTCTCGTTCAGTGGTGGAAGGGGAAGTAAAACTCCCCAAGCGCCAAATG
GCaggtctccttctccagatcTATCGGATCGCGGACCAGGCCCACGTGAACCGCTTGTAACATTTGCAAACGAAGGATGATTCACCTTACGGCGAGGTGA
CTGTATCGCATCCATTCCCCAACTCAGAGCATTCTCGCTTCCCAACTTTTGGATAACTTCCTCCCGCATTTTGTTTTCGTAATGATCCAGCGCTGAATCG
ATTACCTCCTCTGTTTCCAAGAAAGTTTGTCGCTGCTTTACACAAATCCATCGTTTGTGAAGAGTATTCGCCGTCTCAAGAATCGACGCTTCTGACTTAC
TTGCCCACGACTGAGAATTCTCCGACAACAGCAATGCGGCCAGGCTTGACACGAGTTGCGAATCCATGCTCAAGAGCGACGGACTTAGGGTCGGAATCTG
TTTCAATAAAGACGACAATGCCTTTGATGACCTCCACCGTAATTGCTGCTTGTACATTTTCAACCGATTCCCCAATACATCCTGGACGGAACTGTTTTGA
GGCAGGTCAATATCGCAGTGCGTTGCACACCCCTCATCAACACAAGACATCACCATCGACGATAGTATCGTAATGATGTTCTCAACATCATCAAACATGT
CGACAAGAGCTGGAATACGCTCGACAACCTGAAGCTTTGCGAGTGCGAATGTCTGTGCTCGTGCATCCGTTTCAATTAGTGGTGAAATGGGCCCTTCAGC
GTTGAAATCTACGACAACCTGGGCCAATAGTTCCGTAGTGCGGAGATCCCTAGTAACTCCTGAAAGCACACCCAGCTTGATCGATTCCTGGACCCCATCA
TCACCAATAGTGACAAATCCACCTTCTCTGAATCCTTCGACATGCCCACCAACAATACTCACTGCAGCTACAACCGTCGCCATTCCATCTAGGGCATCTT
TCGCCTTTTGCCAAAGCATCAGTGATTGTTTATCTCGCGTCGTAGTTTCAGATTCGTCACCCTGAGTATTGCACTCTGATGCATTGTTGACCGTCTCGTC
CGTTTCTGGAGACGAAGTAGTAGTCTCAGGTTTTCTGGTATCGTTCTCGCTACTTAGACCACCAAACACTGCGGTCTGTAATCCACTACCATCGGCCTGC
TGAATGTTAGTGTAATAGGCGCAAACGGAATCCAGCCACTCGCCAACTTTATCTGACTTGGCAAAACCCCGGTTTAGCGCGGCATTGATCGCTACTTTCC
ATGTAGGGTAAAGCGTGAGATACCTCAGCAGTGCCACGACTTCAGCTGCCTTTGCCTCTGCAACATGCGCCTTCTCAAGCGTGGATTGCTGGATATGTGC
GATTCCGGTGTCTTTGGTCACGGTTACCCCCTTCAGACAACGCGCTGATTCGCATAGAGCTGTACTTGCGCACTCCAATCCTAATTCATGTGTGCAGAGA
CGCgggcgaagaagaagtgggaGTCCCACCAGCGTCATTAGCATGGTGAGAATGTCGCCCTGGAGACCAGGAGCTGATTGCTGAGATCGGTAGATTTTGT
TGAGCGCAGACACAGAATGCTGAGGGAATACCAACATCGCTAGTCGGATGCACATCGTCGCCGATGCTAAGTCGGTCGAGTTCATTCCACTGATAATGTG
AGCCGTAACCACCGAATTTGTTGCGATGATGGATCCAACATTATTGTTTGCAGACCCACACACCAAGAGAACACTTAGTATCTGGTTCCTGTAGAAGTGA
CCATGGAGAGTATCAGAAGGCATACCATTTTCCCCAGCGACTGATGAAGGCATGGTGAGCTTGGTATTAAAGTACTCCAGAAGACCAACGCAAACTCGCT
TTAACGAGACAGTTGTTGCTGATTCATAAGACGCTGCCGCGGTCGGCATCACCAATGCGCTAGCATTTAGAGAATCCGACCGCAACAATGTCAAGTTTTC
CAGCATGAAACTTATGAACTTGGATAGCACTGGATTCACACGGCTGGTTGACCCGGGGTGCTTTTTGGTATGATCATTGGCATCTTCAAGTGACCGATAC
ATCAGAGCACGGGCCATTGCccaaccagcagcatgtaACTTTACGAGAGGTAACTTGCGTTGTGGATAGCCACGTTTGATTTGCAGTGGCGTATGCTTAG
CCACGGATGAATCTGCTGTGTGTTTGGTGTCaatctccttcatcaacgaCTCGAAAAGCGCATCAGAGTTTGCCAGGCAGCTATTTTCCGGGAGATCTGT
TGCTTGGCTAGCATCGTCCGTTGTGCCATCAAGGCCACGATTGTCACTGGAGCGGCCTGTAAGGATGTAGGAGCTATAAAACCCAGCCGCTATACGAACC
ACTTCATCATTTGCCAGCGAGTTAGAAGGCACTAGTAAAGGCAGGTCTGCAGATGGAAGTGTTCTTGACCCAGCCCCTAGTTGCCCTTTGTTGTTCCGCC
CAAATACCATCACCCGCCCATTCGACATCAAGATGAGTGTGTGGTAACACCCACATGACGCAGTTTGAATCTTTGACGACAAAGGTAGTGGTACGAATTG
AGCAGTATTCTTGTGATCTTTGCTCCCGATTCCAAGCTGTCCATAGTCATTCCGTCCCCACGTAATTAGCTTGCCTTTCTCGCTGATCGTCACAGTGTGA
TAGTATCCACAGCTCACAGCTGCAATTTTCTCATCGCTCTCCCCTAGTGCTGTTTTTACCAGAGCTGGTACTTTCGTGTTGCGAGCGTGGCCTAGACCCA
GCTGCCCGTAGTCATTCTTTCCGCACGAATATACCTCACCACCACTAGTAATTGCGATAGTGTGATAGAGTCCGCAAGCCACAGCAGTGATAACTTGGCT
CGATAAGGATTCCACCAATTGCGGGGTGTGCTGATGTTGAGTGTGGTCAAGACCCAGTTGCCCACAGTCGTTCATACCAAACGTTAGGAGCTCACCGTTG
CTTGAAACGACAGCACTATGGTGGTAGCtcaccgctgctgcagttaTGTGATACTTTTCGCGCAAACTTTCAATCATACGCGGTGTATGGCTCTTCGAAA
TTGTCGATCCGAGTCCCAGCTGACCACGATCGTTGTATCCCCAGGAGTACACagctccgtcagcagcaacagctagCATGTGTTCGCATCCATTCGCCGC
AGCAACCGTATTAATTGCAATTCCACCCAAAGCGCGAACGGGAGTGGCGATAATAACACGCTCCTCAAAAGTACCATTGCCACATTGGCCACTTTTGTTG
AGACCGCATGTGAATACAGCACCGTCCTTCATAACTACAGCGAGGACTTCATTTCCTCCTGCAATATCACGAATACCCTTGGCAGAAAAGAAAGGTACAT
GCTCCAATTTGCTTGTTGAGTTACAGTGTCCCAGGCAAAGTTCCCCATAGTTGTTTTGTCCACAAGAAAACAATTCGCAATCGTCGAAACTTGCCACAGT
AGGTACCCTTTCAGATCTGCCAGTTTGTCCTGCTGTGGCAGCTCCCGCGTTGATATCTCCGGGTCCATGTGACGATTTCGAGGCATCGGTTAGCTCTGCA
ATTTTCTCGTTCCACGACCTTCGTGGTGGGCAAAGCAACTTGTTCATGTTCGCCTGTTCATCGTTGGATTCACTGGAAGTGTAGACATAATAAGCGGAGT
CTAGGTTGCCGCGGTTGTCATCGTAGCATGCGGCACACAACTTGATGCTGTCATCCTCTCTTTCCCCATAGTATACTCCATATAACGGCATTCTCTTGCA
TTCTTCACAGCTGGAAGACTCTGACATGGTATCGTTGTATGCAGGTCCATTATCGCGGTCAAAAATGCCGCAAAAACCAATGTATCCAATGTCGATGTTT
GTGCCAGCCGATGGGCAAATCGCTTTTATGAGAATATACCGACCAATAACTGGATAGGCAAGCTGCTTCGTAACGTGAGCGCAATTACCGTCCAATACAA
AGAACGCAACTGGTACGTTTTCATCACGAGGACAGCATCCATTACTTGGAGGGAATGGTAAAGCAGCAAATTCTTCCGCCGTCATATTGTCGAATTCTTG
GAAGTGTGCTAAATTAGGAGGGGTGCTGGTGATAAATACCATGGCACAGCGAAGAGGACTCGAGTAACCAGGCCCAGGACCTCGGATATTGATGTAGCTT
GCACACATTGGAGTGTCTTGCTCGTGTTTCAACACCAGGTTCACGTTTGCTCCCTTCGCAGAGCTATACACCGTTGTGTCATCCAGAAGACAATTGCGGG
CAGCATGCGAGCTGCTAAACTCTCCGCCGTCGCACGAATATACTTGAAGCTGTAAGCTCTTTCCTAGTTGGAGTTCATTCAATGAAGACATGTGATGGCT
CTGGAGTTTTGTTGCTGGGTAGAATACGTGAGAGGGTAATTCGAGACGAGGCCGTGGATGGAAATTCACATCGAAAACCGTGCCATTGCAGAGTGCCGAG
ACTGCAGGAAATAGCGGCTTGTTCAGTGTCGCAAGATTTACGTGGCATACTTCCGGTTCCGAGCGGTCTGAGTATAAGGTTACGGTGGACTTTTCGAAAT
CAAACAAAACTCCAAAAATCCCCGACTCTACCACTTCCTCTTCCCTCTTCCACTTAACATCCAGTTGTTGTTTAAGTGGCTCATCAAATGCCGAGAAGTC
ACTGCCCACAATTCCAAAGCTAAGCGCCGACCGTCCATCTTTTCCCGCCGCCACAACGCGAACTTCAACGAAAATACCTGCCTTTTCGAAACCCTGAGTT
GCAACAATAGTCTCGAATTGATCCGTAGATGAGCTGGCGTCACCGGCACACAGAGTTGTTCCGTTTGGCATCAGTTGCAAGCGCCCTCCCTTACGTTTTC
CGTTCCAACTAATAGACGCACCATCAAAAGGAGCTGCAACGAGTCCTCCTGAAATGACTGCACTTGGGAATTGAAAGTAGGAACTAGCACACCACAGCTT
TGATGGGACAGAAGGCGCTAGGTCCCAGTGAACATCTGAGTCCTTAACACCGACCGATGGGAAGTAGCCACAACCAACCAAATCACTTGGGGGTAACGCG
GCCACATAGCACCTTTTGCCACCATTGTAAAACTCCACTTGCCGCTCCTCGCAATTTAGTAGGACGCCAAGCACATCTGCCCGATTCCATCGAATTCCTG
ATGGCCCAATCATGTCACCACTGGATCCTTCGCGGTGAAGGAGCAACCCGCAAAGGCTGGAATCACCAGGGGAATACATATTGAGATCTGCTGTGCCAGG
GATGACGCCAACAAACACAGGAGTATCTCCAAGCGTGCGCACTGATACTTCCCAATACCAACGACCCCTAAAGAAAGCTTTATCAACCACCGCAAGCCCG
CCACTGTCCTTGGATACGGTAGGGATCTGCAAATTTTCGTCACATCCATCAAAGCTCTTGTGAGTGATCGTGAGCTTGCGAAGATCGGTCCCAAGCGTGA
TGTACCGCGAACAGATTATATTCGGGTATTTGGATCCCGTGGCAGCAGGAAGTATGGCATACTTGTCTGTGCTATTGCCATCCGCCTGAGAGTTGTCTGA
TGCGTCAAACTGAATGAACCGCTGCCAACCTTTCCAACTCGTCAGATCTGTCAACAACGACACCAAATTCGTACGCTGAAGGTGGTCCCAGTCCAAACCT
CTGTACGGGAAGCAGCAAGCCTCCAATACAAGCAGTACATCATGCACAGCAAACTGAACAGAAGTTACTGACGACTTCATATCACTTGACCCGCCACCCA
CTCCACCTTCGATAAGCTGTTGGACTTGGTGAAGGTGTCCAGTAGATGATTCAAGAAGAATAGCCAGCAACTGGAAAAACTCCCGCCCAATGTCGTCTGA
TAACTGGGGCCCAGCAAATTCCAGATCAACGAGATAGTGAACTTTGATAGCCGAGAACTGTTCGGTAGGCCGCTTTCCCACATATTCTCCACTGCAAACA
CGAACACGCTTAAAAGCGGAGGACAACATGGGAATTACGTGGAACCGTGAGCTTGGCACATTTTCGGCGCACTGAAGTAAACGGACAAATGTTTTGAGCC
CTTGTAGACGATTCTTAGCGCGACTCTGGTGTGCAAGCAAGATGTCTCGCATTTGGTCTTCGGGGTGTCGAGAATTCTTTTCGTCCTCTCGACCTAAAGT
AATCAGATTGCTGTTTGATTGTTGAATGAACGAGAAAATGTCCGCTTGTACctgttcatcttcttcttccatcACTTCTACCGACTTTGTTTCCATCAGC
TTATTCAACTGACGAGTGAAACGCTTTTGTTCGGGCTCTTCCGCTGTAGATTCAGCTGGCTCACTCTGAGAAACCTTCGCGAAATCTGTCgttgaacagc
agctgcacgtTAAGATATGGGGAGTGGAAAATTCACCGGGAAAATCTTACCATAATTTGTTGCCATCGAGATCCCAGGAAGGAGCTTCATCGGAGAAGAG
GCCGATGGGGTAGATAGAATTGGTGCAGGTGCcaactgaagaagaagaagtgccCTGCGGATTATCGGTTCACATACAGCATTATATAGTGCTTGTTGCC
TCTCCTTCACGCCCATGTCAGGAGAAAATTCGCTAGGTGCTCCCGCctcactgcagcatcagcaatATTAGACTTGAGAAAAACGCTCGAGATCAATAAA
CTTGACAAGTACTAACctagaagctgcagccaattTTTGCTGTTCTCGCACGATCCTAAGCGCAATCAAAACAAGTTAGAGGTGCTTCAAGAATGTCATA
ATATAGAGAGCATTGGTCATTTACCAACGACGCAGCTGTAGGGCAGCCTTCCATGCGTCAATCACCGCTTCAGCTAGTGCCCCTTCATTCGAAATAGGTT
GGGTCGTGTACGAGATATTGGTATGTTTCAATAGAGCAGCGAAAGTTGCACGAACTGCCTGATCCACCGCCTCAATCCCCCCACTCTTTTCTAGTGTCGC
TTCCACACTGTCTTGTCTCTTCAGCCTCGCAACGCGAAGCTGTGGGTTTGCGCTACCAGGTGCTGATCCAGGATTCACAGCATTTCGCACTTTGTCTAAC
AGTTTTTTGCCATTACCGACGTTGTCCATTACTTGTAGTAGGAGCGCTTCATTCCGACCTACCTCATTGTTCTCAATTTTCGTTGAATCTTCCAATCCAC
CCCGGAAGAGCGGAGAATGCAGCCACCTCTCACTGAGAGTGACACCATTATCTGATTCACCGCCAATAATTAAAGTGGCGGCATAGTGACTCCCGACCCA
GATTACCATTTTTTGGAGATCTCTTAGCCAATCGCAACTTTCGTCAATGGTTTTGTCGGAACATCGTGCAAACGTAGAAGATGGTTTTGTGAGAGACTGT
GGTGCTGGGGGTGGCGCTACACCATTCTCGGCCTGGCCTGGAACTGGCAATGGACTCTCGCTCAATGGGTATATGTGCTGAGATAGAATAGTTCGGCTGG
GCATGAAAGAAATTTTCCTTGGGTCGTACTCTAGTGCCTCAGACTTGGTTCCAGACCTTTGAGCCTTTACTAGCAGTGTTTCGGTTCCAAAAAGTTTTGC
TAGATCTGAGGGAATAGTCACCCGTCGGATCTCCATGTCATGCTGTACATCTTTCACTTTCCAATACGTGTATCCATTTGAGGTAGTAATTTTGTCCCAC
AAGCTCGTGAAAATTCGACCATAGGTGACGGAAGAGCCActgttctgctgcagaaggctTATTGAAAGTTCTTGTGAGACGGAAGCTAGCGCTGTATCCA
CGAAGTCAATTTCACCGCCATCGCCTCTGTGGGTAGCAAGGGTCTCAATACTTGCCCCGGGAGCCAACAACAATCCTTGATTGCCCAGTACTGAAAGCGT
TGTGTGCAGTTTCGACGCCAAAGCTTCTAGTTGAGACCAGAACGAATCCAATATGGTGGGAAGTGCGTCACGAACGGAGGGCAGTGAACATACACTGAGT
AGCACAAATGGTAACAGTTTGCCCGAGAAACTCCGCTGAATGAGCAAAGGAAGCAGTTGACGCTGCTCGGGTCGCATCGCATCGTACTGGCCCAAACACC
CCGTTATGAAAGCCACCAACTTTGTACAAATCGATTCAACGATCATCCAACCTCTTTTAGTGGAGCACGAACACCAGAATATTGCCGCACGTAGCATGAT
GTTAAGGCATTTAAATTCGTGACTGTTTTCAATAGCATCGAGGTTCTTCAAGAGCGCGGTAATATCCTCTGACGCACTCTCCGTTGCGTCCTTTGTTTGA
TCCCCTAGCGTATCCAACAGCGTACTCGTAAATGTAATCACGCTTTTAGAAACAATCTCGTCCGATGAAGCATCCATTGTGAAAAGCACGTCAGGGTCAC
TTATCAGTTGAAATAGCATTTTTGCTGACGTGAAACACGGCACAAGTATCGGAGTTAATAATTTCTGCGCTGGAGTCAACTCTGTCTCAGAGTCGTGTTT
GTTTGCCATCAAGCGATTCATGACTTGTAACCTGTCCAAAAGCGATGGGAAGAGGGTTGAAAATCCGTAGTAGATTGCCGATGCGGTTTCTTGCTTCACA
GCATGATAAAACCATAAAACTTCCCCAGATAACGGTATCTTTGAAACGTGATCCGCAATCGTAAAGAGCAGGCCACGAATCGAAAAGAGCACCCCTTCAG
GTTGAGATGCTGCCACAGGTAAACCAACCTCAGATCCATCCAAACAGCTTCGCGAAAACTAATCAAAGTGTTAGCACATCGGAAATGGTGAGTTCGGTCA
GCAGAGTAGCTGTGCAGCATGTAGAAAATAAAACAATAGCCGTACCTCGAAGAAATTTAGCTTGAGTAACCTTATTGTTACCAGCAACGGATACAATACG
TGGGTTACCGTAGGTGTACTGGACTTTTCATCTTGAGCACCCATATCAAAGAAGCGGGTCATCAatttttccagcagcgcgtacaACGCTGAAAACGTCG
ATTCCTTGGGGTCAATACATAGAAACCGGTATAAGCACCGTGACAGCTGAACAGAatctccgtcttctgctgGGATATCATTTCCAGCTAACCGATCCAG
ATGAGATAACAAGCAAACAGCAGAATCCAAGGCCTCCGTCGCACAGTGTTGATTTGGCATATTCGCAGTTCCACACTTCGCCCGAAGGGCACTGAGAACA
AGTCCTGATTTTCCGGTTGTCGACATATTTTTAGTCATGTCGAGACTGAATGATCCTGACGAGTCTACAGGGCACACCGTTCGGACTTCGCTGCAATTTG
ACACTTTTCCGTTAATGCTGGTGCGACCACCCAACAGAAACAAGGTGTTGTCTTGAATTGTAGACGGTTCGATATCAGACATACTAGGAAGTGCAGTTAC
TGCACCTGTTCGAACATAGAAAGCTGCCGAACAACATCCACCCAGCTCTCCTTCCGTATTTACTTCAATGGGATGCCACTTTTGCAATGTTACGGAAAAG
CACCACATATCGCACAAGTAGGTGCTTGTTCGGTTGAGGCCACCCAAGATCCAAATGTTCCCAAGGTCAGAGCACATGCTGTAATTAACTCTTCCCTCTG
GAGACGTCGGCTGAGAGTCTCCACTCGAGCCGACTGCTCCAGTTTGCGAAGGCCCGATGTGATCATCATGGCACAAGTGCCAAAGTCGGTCAAATGTGTT
ATATCGCCAGAGATCGGACCTGAACttttcttctcgatcttgCCCTCCAAAAATGTACACACACTCTCCAATGACAGTAGAGGAGCATCCGATTCGAGGA
CCCGGATCTAGCGATACCGAACTAGGCAACCGAGACCAAGCATAGTCATCCAATGATAAATACCACGCGTCTCCGAGAACTTCGTTGTCGACGGATTTTC
CACCATACATGAATACAATTGTGTCAAGACGAACGCGAATTGTTGATGCCGTATGAAACGCACGAGCCTGAGGCATTGACGTTGCAGCCCCCAGAGAAGC
TTGAATCAATGTCCATGTTGGGAGCGAGCCGTCTGCGTTTTTCACCGTAGAGCACTTGTACAAGTCCATGTgccttgaagttgcacaattGTTCTCACCA
CCTAGAACAAGAATCTGGTCCTCATCTACTACCACAACTTGATGATTACAAATTCCAATGGGGAAGTCCGACCACCTCTCCCAGCTCTTTACATCAGTAT
CGTACACCCACACTTGGTTTGTAGGTTCAGTAGATTGAGGTAGCGAGGCTTCACCAGCGATCATtccaccaacaacaaacacCTTATTGCCTACTAAGGT
AGAGGCAAATCCTTCCAGAGGTGGAGGGTGCACTTCTGACACCTGATCTGCTGGTGATTGAATCACTGCACTAGAAGAAGGCATCGTAACTGCTCGAGAA
ATACTCTCAAACTTATGACCACGGCCCGGTGGGTAAGCAAAAGGCTGGTGTCCAAGATTGATACGGATGATTTCCCCTCGCTCAAGACTGATGCCAGGCA
TCATACCCGATCTCTTGTCTCCCGAGGAGCACTTGAATTCTGAATACGCAACGCCGAGATCGACTCCGTTCCGGAAAAATGTCATCTCTTGTGTGTTCAA
GTCCAACAGACAGCCAATAATATCACCAGCCTTCCACTTCTCTCCGTAAGACGATGACCCACTATTCCAACGTCTCTGGCGATTGCCGTCGTAGGACCAT
GAATGAGCGTGGTCACCGACTCCTTCGCCCTGGTCTGAGCTCCCCTGGAAGTAGCCATCGATCCATCCAACTTGGATCAAACCACTTGtgaccacctcca
cctcgtaAAACCACTGACCTCGGAAAAGAGACACGCCAACCGTGGAAATGGAACCAAAGTTACTTAGACCCTCAATTTCTCCTGAGCGGTCGATGTCGAC
TCGACCACAGATCGAAACGATGCAAGATTGGTCTAACATTATCgcatcgccgtcgtcgttctcTCGTTTTCGCTCCACGATTAATGAGGTTGTATAAAAC
CCAGCTGCAACATCCACACAACGACGAGAATTTTTATCCGGTCGGACCTTAAGTGGGACTGGCAGCAATGCGTCAGCACTCCCACGATTCCCAAGCTGCC
CCTTGTTGTTCCGCCCGAAAACGAAGACTTGACCTTgctccgagagcagcactGAGTGGTAGCACCCACACGTTGCCCGTATCATTCGCGTGTTGGCAGA
CAATGCCACAACATTTGGAATGTTTTGATGAATCTTGCTCCCGACTCCTAGTTGTCCATAGTCATTACGGCCGAAGGAAAAAGTTCTACCGCCAGTGGTC
ACAACCACTGAGTGGTAGTAGCCGCAGGCAATGAAACATACCATCTCATTTGGAAGAGCAACGAGAGTGGGTACCTTGACCTGGCGATTGTGAGCCAAAC
CTAACTGTCCATAGTCATTCTTTCCGCAAGAAAATAGTTCGCCTGAAGTTGTACAGATGATTGTATGATATAGCCCGCAAGCAACCATTGAAACTTCGGC
ATCCTCGAGGGTTTTGACGAGCTGCGGTGTCGATTGATGTTGTGTGTGATCGAGACCTAGCTGACCACAATCATTCATGCCAAATGTATAGAGTTCCCCC
GAATCCGTGATCACCGCACTGTGGTGGTAACTCACAGAGGCGTATCCGAGCTTCTTATCTTTCAACGACTCAATGAGCTTTGGAACGTGGATCTTGGTTG
CCAGATTTTCATGCCCCAATTGTCCTCGGTCATTGTAGCCCCACGAGTACGCCGACCCAGTGTCCGTTAGCGCGATCATATGCTCGCACCCATTGCTTGC
AGCGATAAACTTCACTCGCAGGGATCTCAGGGCCTGAACAGGGCGGAGCATCATCACTCGTTCATCAAAGTGTCCCTGGCCACACTGGCCACTCTTGTTC
AACCCGCAAGTTAGCACAACACCATCGTTCGTGAGAACCGCCAGAGTTTCGTTGCCACTAACCACCTGCCGGATATCGTCCCATCCGCATAGTGCTACAC
TGGTGAGCTGATGGCGCTCGATATCGTCTCCCGTGCCTAGTTCCCCGTACGAATTCTGTCCACAACTATAGAGTTCCCCCGAAGCCTCGCACTTTCCGTA
CATGGGTTGTTCCTTCAGAGCAGCGAGTTTACCGATTGACGTTTCCAAATTGACCGAGCTCGTTGGTGGTTGCTTCATCAACCACAGTACCACGAAGAGT
AACGTTGCAAGGGAGCCTCGAGCCAGCGCTACCTCAGCCAATGTCTCAATCGTTTGAGCTCCAATTCGTAATTCACCTTGCGGCGTTCCATCAGTGACCG
GGTAagcaagttcgccaagaCATTCACTCAGCAGATTAAAGGCTGATGATGCCGAGGGTGCAAGGTACATACTGTCCGCGTAGGCAGTAGGCTTCAGTTG
CTTCAGATTGTCCTTGACCATCCGCAGCGCTTGTTCATATTGTTCTGGGTTGTTTCTGCGCGTAGCCTTCAGTAGCATCACCACCAAATCCCAGCCCATG
GTCAAGCAGCTTTGCGTCGGTAGtggtagtggtggtggcgacacTTTGCGCAGTGTCATAGCTTGCGCTCTAGCAGCGAGCAGTCGTTGTTCATGTCGAT
AtttctctttcttcgtcatctgGTACACAGTCTGCAAGTTCTTGACGTAGCTGGCCACACGGGCGTCGAACACGCCTGGCATCGTCTCCCCCACGTCTCG
TTTGGCATCGTGTCCGTCGTGCGTTGGTAGCCCCGCCAACTGCGAAATGTGCTGGAATAGCTCGTCCACCGAGTCCACAGAGCTCACGAGCTCtttcatc
tgctgctccgggCTGCGCGTGTGCAGGCGTCCAGTCACTTCATTCTCTATAGACAGACAGCAAGCACCACGTTAGATGAATTTATTGTATATTGATATGA
TTGTAAGAAGTGCCGCCACCTTTTGGCAGGTAGCGCAATGCAGCGCCGAACTCAAGGATCTTGTCCATCGCGTCTTTGGCGTCTTCagaggcggcggcca
cgcCCGTGTCTCCGGCCTTGAGCACATCGCAGAGCGGTACGTAGGGCGCCTGCAGCGGCCGCAACTGCGCGCGCTCGCTTGGCGGCTGCGTCACCGCGGC
TGGGAGCGAGGCTTGTTGCCCCATTGGCGTCGAGGTGGTTGCTCTCTCGACGCTCACAACTCGTTCTGGGCGGAGATCGGGGTGCGCCAAACGGTTGGCG
ACGCTTCACGGCATGGATCTTGTTGTGTGGCGGGAATAATTGGGGAGTTTTGAAAAACAGGGccgattttttttttaactGTCGAAAAGCCTTAGTTCAC
GGCCCGCGCTAAAGATCAGATAAAGTAGAACAAATTGACGTCGTGCATGACAGCGAGCCAACTGTAGACACATTTGAGCCCATGGATACCAGGAGCGCCA
TCCCTAATACTCGGTTCTTCATTCCTTTCCAAGCATTGGCGTGGAATCGACGAACCGAGTAAAACTGCACCACGACCAATGCTTCTTCGCGAAAGACCTG
GCACAACTTCCGACGTCAAACCATACTTGAAACGCGAGGTGTTCTCAAACACCAGCATAACCAAGAGGATCGGAAGCGTGAAAAGCACCGCGATAGAATC
TACGCGATACCAAGTTATCTCCTTCGCGCGCTGGGCTCCAACAGCCTTTTGAGCTTCGACCCCCTCCTCCCCCCTACACGAATGAACCTTCGTATCCGAT
GTCTTCCGCCGATTCAATCAGCGTTCGGATACGAATCACATCTTTGCCGAGTAGGAAAGTTTACCCCGGTCAACAACAGTTCGACAATCGGTTGCCAACC
TCTGTCTGCGAGCGAGCACATCTCAAGTAGGGCGAAAAGCCATGGTCGGTTATGAGCTTTAGAGGCCAACACAACATGCCGACCACGAAATACCAAGATG
GCTTCGTACAGCGGATAGCCCCGCCTCAAGTGGGCCCCCACCCGGTCTCTTTTGTCCGACCTGCTGGCAATTGAAGTTGCTTTTCAAATCGCATTTTTGC
CTCTTGTTGAGCCGCAACCGACTTCGCTTTCCCTTCGCTGGTGGTCGGTCCAATGCGATACTGCGCAAAAATACTAGACCGAGATCGGTTTTCTTGTGGA
TTCCCCTGGCAGCGAGCGCCCGAGACATGGCCACTTTCCAGCTGGCTGGGTTGCCAACGTCTGTCTCCACAGTGCGAGAACCCCGAGTCGCGCGTTGCAC
ACAAGTGCGGAGACCGAGCCGCTCTGCCGCGCTGAATTAtcttcattcttcaattcgtTCTGCTTTGGCAAGTTGCGAAATCGATCAGCAGCACTAACGA
TTGTCGGTGCCTGCACCTGTTTCCTCCTTCGTTGCACCGTGTGCAACGCCATTCTCACTGGGATACGTAAGCCTAGCTTCTCTCTCAAGCTTTACTTGTC
CGCCCACATCTGTCTCCCCTCCGTGTTGAAAGATACAGTATCGCCATTTTTCGACTGCTCCATTCGCCGACTATAATATCTGCGCGGCATCTGGTAGATT
GGAGCTGCCCTCTATCAAGCGAGGGGAGAGAGAAAGCGGGTGTATACGAAGAAGGGGAGGAGAGACCATGCCAGTTCAAGTGCAGAGCGACTTGCCTGGC
AGAGAGCGCTATCTGCACAAGCCCCTCGCACACCGAGAGGGCCCCGTGTTGCCCCGTAGTCGAGCTATGAAGGCGGTCGCCCCCGTCAAACACAAACCAC
TCGTGAAAAGCCGATTGGCCATGGCGCAAAAGAGCGAACGTGTCAAGAAAGCGCGGCGCCTCCCGAACGACGAGAGCGTCTTCTATTCGAATATCTGGTC
GCCTCCCGAGTCCACACGTGGCGTGCCtgccaagaccaagaaatcCAAGCTACTCGTCGATATCAGTCAAGTAGCGCACGTGTTGACCACGATCGACTAC
AAAAGCGGCTACGACGGCCCGACCAACGAGGAGTTTTTCAATATCTGGGCGTCCATGGAGTCGCGTCAGAACGCTATCGTCACTGTCACCACGGCAGCGC
TGAGTaagacgcagcagaatgcCAGCAACCTGTCGACACCAATTTCTGAGCACAGCAGCGAGGCTAGCTCGTCTGTGCTCACGTCGTCCGTGTTGAGTCT
TGGACCACTGCGCATGGACACCAATACGCTCCAACAAGAATTATCGGCGGATGATTTCAACTATGTCATGAGTGCTCCAGTCTCCGGTCCGCAACGGAAG
GGTGAGAATGTGGTCTTCTCGAACGTGCTAACGCGCAACAACGAAGTGGACATGAGCTGGAATTCGCAGTTTTTGCTGGGGCTACATGAACCGGTTCGTC
ATGCTCTTTTCGTGATTGACAGATTCTTAGAGCACAGCCGCAGCTTGAAATCGCCCATGAATTGGAATGTGGGCGAGTTTTTCAGTTGGTTCAAGCTGCA
TTTCGTCGAATTTGTTCGGAGCCAACACGATGTGAAAACGACTGTGCTCTTGCCGCTCGTGGTGATCAAGTTTGTGGAGAAGCGCGATATCGTTGCTATG
TATCAAGCTATCTTCGCGTTGGTGAATGTAATcactgctcaagaagatgagTTAGTGCTATCAGCCGCATCGTCTGCGGACTCGTGGCAGACTCGACTGG
GCATGTTGCAAGACGATATTCGCCGACTTAATCACCTGCTATTCAATGCTCTGGCACTAGAGGAAGAAGCCTTCAAGCCTGCTATTGAGCTCGCATTTTC
AGAAAAGGCTTTCCACAAGTACGTGATGCCTCGAATCTTTCGTGCGACCAGACCGAAGCGGGTTATGGTGCCGTGGATCGTGGAGCGGAGCCGTGTCTGG
GGAGGCAACAAGGTTGCTA