Description :
From Genome Similarity Track
Location :
Scaffold_72:41713- 43746
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.58WD repeat and HMG-box DNA-binding protein 1
Pytap_DAOMBR444maker-pag1_scaffold_72-fgenesh-gene-0.7Phosducin

Sequence
2033 bases(100 bases per row)
CGCCGTTCTCGTGGTCATTCATCACACTATCATCCCAGTCTTCTCGAGCGCGACGTGGAACAGCGAAGAAGGCACCGCGGTCGTCCAAAACAGCCATGGA
GAAGAGGTAATTGTCGCTGAACTTGAAGCCACGTCGAGACTTGTCAGCGAACTCGACCTTGACAAGATGCTCACTTCGGCTGGCACCGCGAATACACTCA
ATCTCTCCTAGTGGCGTCCATGCCAATAGAGAcACGGATCCATCCGTCACGCTACCCGACTGGAATGGTTCCTGGTAAGTCTGGAATGGCGATGCTGCTG
CCGTGTTACGAGCAAACGTGTTGCTCGTGAACTCGACATCCTGGTCGTCTTCGTCATCAAGCTTCTCAGTGGACAAACCGAGGTCGGCGTCTGCGCTTGC
GGCAGCTGATCCAAACCCAAAGCTGGCCTTGATCGCCTCCACACCAGTCAGTTCCGCTTCCTCATCATCATCATCGTCGCCGTCATCACCGTCCACCACG
GCTTCATCATCGACAAACTGCGAGGCATTCAAGCGTTTCTTCTTGGGCTTCTCGATAGTCTTCTTCTGGGCAGTCGATCCGACGCTCGACGTCGTTTGTG
CACCAAGTCCCGTGTTGTGCGGGGgAGTGAGCCCCATCGGGATGACGTCCTTGACGAATCCGAGACGACCACCATTATTGAAGACAAGCAGAGTATTTTG
GCCCTCtGCCCACTGGACAGCTACGATGTCATGCTCGACTCGAAAGGACCGCACGATCTCTTTCTTCGACACGTTCCAAACGAAGACCTCCTGCTTAAGA
GTTGCTCCAGCCACATAGAGACCATTCGGCGACACGCTGAGGATGTTAATATCTGCACTTTTACTCTTGCCAATGGGGAGCATCAGTTGGCCTTTGCTCT
TCCATGTCGTGCGGTCGAAGAGCTCAAGAATACTCTGGTTTACTGGGACAACAAGCACGTCTGGCGTCCAGGCGCATCGGCAGAACACTTCTTCACTGCG
GATATCGCCATACTGCACCTTGAAGACGGCCAACTGCGTCGCACTCaTGgCCTCTTCGTTCAATTCAAAGACGCGAACCGTGCCATCCTCACTGGCCGAG
CAGAGGAAACGGTCATCGCGTGGATCAAACGCCACGCTCTTGACGCCGTGCTCATGACCTTGGATCGCGATGATCTGATCTGTTGCCGCTCGACGCAGcA
CTTTGATCTCCGTGTCCTCAGTCGCAACGGCAATaTACTTGGCGCTGCAGGCAACGTATCGGATCGCGACGGGGGAgCGTAACAACAGCGCGTCCCGTTC
AAACTGTGGTGGCATCTTATACGAGTACAGCGCATTCTCATCCCCCGAGACGACGAGCAGGTGCGTCTGCTCAGGCACGACGGCCACCGCGGGCATCGTA
CCATCACAAACAACCGCATCCAAAAACGaCTTCTCCGTGTTGATGTCCACAAAGTACACAACGCCATCCTCGCCCGTGGTCACCGCCACgTCGTGGCCGG
CTGCACCATCgTCCGAGCTCGACAGCGCCCGGGCAGTGCGAAAGACCGCtAGGTCTCCGACGCCGGGAGCGTTGAGCGTGATCTGCTTCATGGTGTCCAT
GGTGCCGCGTCGGGGAGGCCTCAaGAATGGGCGCCAATAGTGGGGGATGTGTTGGCGGGAAGCGGAGCGACCATCACTCTGGATGCAAGGGAAATTCGGC
TAGCCTAGGCTATTTCGAAACGCATTGTGTGAACTACATAATATCGGGATAAAATCCGTGTTGTTGTTGTGTGTCATGTCGCGGTGTGTCGAAAGGGCGA
GTGTTCTCGCCACATCACAACCAGAAGGAAGGGAGAACGCAGTAGCAGCATGGGCGATCGCGGTAACGTGTACTACGCGCCAACGGGCGAGACGACCGAG
TGGGAGGACATCCTGATCAAGAAGGGCATCATCGCGCCCAAGACCAAGGTGCAGGAAGAGGAGTCCGAATCCGAGGAAGAGCAGGTCGACCCGCGCCAGA
ACGCGTCGCTCGACGAACTCGATGATCTCGAAG