Description :
From Genome Similarity Track
Location :
Scaffold_80:4170- 6045
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_80-snap-gene-0.31Kinesin

Sequence
1875 bases(100 bases per row)
AGAACTGGTGGTGCTAGCTAAGTCGGCTTACCAGCGCTTTTAGATGCCGGAGCTTCGTGGAGTCAGCGAGGATGTTCTTCGGAGCCATCGCACCGCTGGT
AGATTCAGTAGGCGGTCAGTAAGAAAGTAGACTCCACTATGCCAATGAGCTATCATATGGAGTGCGTACCGTTGTCCATTGTTGCCGAGCACGCTGAGAA
GCCGACCGACGTACGTGTATAGCTCTAGGCAGTCTTCTCGCAAGTTCTACAACACAAGTCAAAACCGTCCTGAGAGGTCAAACATGCCGCTCCAAGTACA
AAGTGAGAATAAACACACTGGAGGTCTAGCGTACGTCGACGGTGCGAGCTGTGGAGGTATGCAGTTGCTGAAGTTTCTCGTTCGCAGTGTCCAGGTCGGT
GCTCTTCTTCTTCAGGATCTGATCGAACTGATATTTGAAATCACACGCAAAGTCAAGAAATGTGTGAGAGGAGGGTCAGTATGGCGATATCTGAAGAACC
AGCCGACAAAAAGGACAGAAGCAAGTGCGCACATGCTGTCGAATGAGCGCGATCTCGCCTTCTTTCGAGCTCTGGAGAGCTGCGACGCGCTGGAGGAGTT
TCTTTTTCAGCACGAAAACCCGAGCAGTGCAGTAAATCGTCAGACCACTTAGGTAAAAAATAGTTCAAGACTTCAGGGCAAAGGATCCCCAAGTCAAGCG
AAGTGTTCGTTCTGGTACCTGCTCGCTTTTGTTCTCGCGCTTCTTGCTCTCGTCTCGTTCTGTGGTATCTGCTCGGACGCTGCTGATCGATACTGACCGA
TGCCGCATCGTCTGCTGCTGCTCCCATTGCTCCTGTGAGTGCGGATTCCTGCTCAGCAACTCCCGGATCTCGGTGCAATGTTTCATCTCCTCGGACGCCA
GTGCACGCTCGTACTCCTTCGTCTTTTGCACCAGACTCTCTTCGAGAGTGGCGATGCGGCGCCGCTGATCGTTCATGGCTTTCCGCGACTCTTCTTTCTC
TTTCTTTGCCTCACTCTGCACGTTTTTGGGAGGGGAAATGGGTTTTATGCGTGAGTGAAGATTTGGTGGGAAATGGGTTTCTTGAGTCAAATTTGACGGT
GTCCGAACGTACCACGACGACCATGAAGTTGTTCTTCGCATTCGCGTACTTTTGCCGGAGGTGGTCGCGGTCTTTCTTGGAGATCTCTGTCAATAAGTCA
CCACCATCACCGCCATGAGTCGCTGCTAGCCAGTATCTCCGCTTGGAGTACATAGCAGATCTCGATCTTACCGTTCGCTCGTCGCGTGGTCTGCATGCGA
GACTGATTCGCCGCTTTCCGAGTAGGCGAGAGCGCGAGACCGCCACTCTCAGCATCACAACCCTCAAGTTTAGCATCCGAGAACACTGACCGGAGCACAA
GTCCGTCCTTTAGAAGTGAAAATACGACAGAGTCAATTTCGTTAAAAAAAATCACAAAGTTCTCACAGATAGGCTTATGGTGAATCGAGATGCCAATCGC
ACCGCAAACTTGATTTCCCCGCTCTCCGTGATCTCCTCCGCGTCAAATCCGAGTTCGTTCAGCGTCGCGACGAATTTGCTGTTATAGTCGGAGCGCAGTC
CTTCGACCTGGCGCCGCAGGATCGAGAGCTCCTCCTGGAGCTTGCGGATGCGGCGGTCCTTGTCTGCGACCGAGCCGTTAATGTGATTCACACGAGGCTG
TTAAAGCACAAATTTGAAACTGAGGTCAGCGTTAGGCTGGCGAAAGAAAGGATATGTGCCGTTGATCTCTACCTGGTTCTGAACAGAGCGGCATCGGTTC
GCAAATTGCAATGTGCCCAGACACTCCTCGTAGTGCTCTTTCATTGGATGGATCGTTGCGAGCAGGATCGTGAAG