Description :
From Genome Similarity Track
Location :
Scaffold_633:417- 3274
Transcript NameFunction/comments
Phymu_g11273hypothetical protein

Sequence
2857 bases(100 bases per row)
CGCAGCTCCGCAAGTCTCGGCGCCGCCAAGCCCTTCGTAAACAGATCAGCAAGCTGAAATCCAGTTTCCACATACTCTGGTTTGATCACTCCTCTGTTGT
TCTCGTCTCTGacgaacttgagcttcacaTCCACGTGCTTCGCCACACTGCTTGTAGCTTCGTTCTCAACCTGCTTAATAGCAGCTTGGTTGTCGATCAT
CACCCGCTTTGGCACCTTCACACTTAACCCGATTTCTTCTACCAGGTTCCTGATCCCCAGTACCTCCCGCACTCCCAACGCCGCAGCCACGAACTCGGCT
TCAGCTGTGCTTAGTGCGACTGCTGCCTGCTGTCTTACCAACCAGCCCAGTGTCATTTCGTTGACTTGTATCAGACAACCAGACACCGACTTCCTGGATT
GTTTGTCCGATGCGTAGTCAGCATCAGTGAACGCTCTGACCGACACATCACTGTTTTTTATACCTCTGCCCAAGTGAAGTTTCAGGCTCGCGGTGCTGGC
AAAATATCGCTTCGTGCGGTTCGCGATCCTCCAGTTCTGTACTGTAGGTGGCTTTTAAGGGTGGCTCGGTGTACGACATACATCGCGTCCGGTCTCACTG
TCCTCACTAACCACAGCATGCTGCCAACTAACGACTGAAACATTTGCACGGTAGGCCGCTCTGGAGTCCCTGGTCCAGTGTTTGGCAGAAGGTCTGTCCT
ATCAACCTCGGAGTCTAGCGTGGATTCATTGGCGATTGGTGAACGCACCGCATTTGCTTTCTCCATTCCAAACTTTTTCAGTAATTCAAGGATCGTATGC
TCTGAGTCAATAGTGTATCCCTCAGCTGCGTCATACCCAATCCTCATCCCAGGAAATTCTCTGCCAGACCAACCTTGAGTTCCATCGCCACCATATCCTT
CTCGAAGTCAAGTAACAGCTCGTCGTTAGTGGCCGTAGCCAATAAATCATCGACATACACACCAACCACCGTCGTCCCTTTTCCATTGGTCTTGTAATAA
ACACACGCGTCGGTCACGGACTGGGTCATCCCCGCTTCTTTGATCAACGTCTCGTGCAGTAGTCGGTTCCAAAGGCGCCCGGCCTGTTTGAGTCCGTACA
AGCTCTTCACTAGCCGTAGAACTACTCGGTCTTGGTTACCGACACCCATCCGTCTCAATTTCTCCTCGCTCAGCTTCATGTCATCTGGAATCTTCATGTA
AATATCAAACTTCGGTTCTTTGAAAGCACGGACATACGCGTTTGGAACGTCGTAGTGTTTTGCTCTGACTCCCCAAACATGCGCGATCGCCAGAATCACT
TTTCCGCTTGTGAGGTCCAGTACTGCTGAAAACATCATTTCATAGTCCCGCCCAAGCAGTTGTTTgtctcctccagccacgATTCTCACCTTGTATCTTC
CAATTTTGCCGTCACCATCAATCTTCTTTTTAAAAACGCTTTTTGAGTAGAGTACGTTTTCGTCTTCCGGGGTGATTACTGGTTCCCACGTCTCGTTGGC
CTCCAGTGAGTCGATCTCTTCGTTAACGCTAGCTGCCAATAGTGCGCGTCTGGCATCTTCATTGCTTTGCGATACGACTTCGGGTCGGGCAAGTGTCTAT
ACTGCTCCTCCCCCACCCCGATAGCCGACATGGCCAGCGCCTTTTGAATTGCCGACATGACTACCTGAGTCGCTGTTTGATTTTGTGGTTTCTGGacttt
gctcttcttggttTCGTCATCCGCCTCTCGTTGTCACTGAGATTTTTCCTTGATCGCATTGACCACCTGAGCGCTCATCCCGGCGTGGATTTCATCACTT
CTTTCTCGGCTTTTGACTTGATAGGCTTCAGTTTGGAAGTCTTGATTTTGGCAGCgtttttttgctgttttttttcGGACGCtgtgctcttcttgccgct
tGTTTGCTAgcgcctccagttcctcttcagcttctcaTTCCAGCACGCGTTTCAGGTGCTCGTTCGCTTCCGCCGACAGTGTCTCAATATTGCCCACGTG
CCGTGTAGTGATCACCGTGTTATGTTTTATCAGCATCACTTTGTAGCCCTTTGTCTCTTCACTCTTTCCAACGATGATTCCCGGAGTCCCGCGTCGATCC
AACGCCTTCTTTGGGCTCGCGTACACCGTGCATGGCGATCCGAACGCTACGATGCCTACAACACTAGCTGGTTTACCGGTGAGCACCTCGATCGGTGGCT
TTCTACCGACATTTGCTCTAGTAGGCATCCGATTCAGTACGTAAGCAGCATATTCTGCCGCGTAGCCCCAATAATTCAACGGCAGTCCACACCCAAACAA
CATGCAGCGTACCATGTTCATCACTGTCCGATGCAGACGCTCTGCTTTTCCGTTCGGCGCCGAGGTTCGCGGCTCTGTCATTTGCCGCGCGATTCCGGTT
TGAGCGCAAAATACATCCAGAGTTCTGTattctcctcctccgtccgcccacagtacatgtactctcACGTTGAATAATCGCTCGAAGTACGCCATGAAGT
GCTTGAACTGCTCGGCTGCTCTGTCTTTTGTCTTCGCGACGAAGATCCGACAAAAATTCGACTTGTGATCTATGAAGTTGATCATATATCGATTTTTGTA
CCTGTACATTGGCGTAATTGGCCCTTTCAGGTCCGAGCAGATAACGGCTCCCACCACATCAATAGGTGCGTTCATTCCAGAATCCTTTTTCCGTTGCGCG
GTACGTGACGGCTTTCCTTCAGCGCAATTCAAACAGTTTTTACGCACTCTGTCGGTGAGTTCGATCCCATTTGCTGAATCCTTAGCCATTCTTTCAACGT
CGTCATAGTTTAGATGCCCAAAACGCACGTGAAAGTCGTGCAGCGACCCTTTCAGCA