Description :
From Genome Similarity Track
Location :
Scaffold_632:417- 2394
Sequence
1977 bases(100 bases per row)
GGTAAGATTGACCCAATACGACTTGATCGGACTCGTCTACGTTTAACCGACTCTGGGGCCGCTCTGGAAACGCCTTCAGCTTTGGACACATGTACCACCG
CGAACAACCGATAGGGCGTGCTTGCGACTGCCAATCTCACTGCATGGTCGCCGCATTATTTAGCTACCCGAAATGGTCCATAACACATATGAGCTAGCTT
TCGAGCGTACCCATCTTTGACGCGATCAAATATAACCATACTTGTGATTCTTATTTATCTTCAGCAGATCGCGGTTTCGTTATGACGATCCGCTCGGTCT
TGAATCGCGATCTTCAGCCGATCATTCACGACTGCCCTCGCTTGTTGATATTGGCGTTGTATATTATACCTCCATCTTTTGGGATCGCGATCGCGGGGTT
TGACACTTCCTAGTGGTAAGGTCGCTACCGACGCCGATCGAGGGTCCCAGCCATGGATCAAGTAGAACGGCGTTTCTCCGCGGACTCGATGTTGCGCTGT
ATTGATCGCATAGGTTAATCGCTCTGCATATTCGTCCGAATCTCTCTGATCTTCATCAGTGACGTACATTTTGATCAATCGTGTCAGAGTTTGAACCTTG
CGTTCTGCGGTTTCGTTCGCTTGAGGTCGATAAGTCATTTTGTCCCGTCGCTTCTGTCCCGCGATTTTGTTGAACGCTCGGAAGAAATCGGACATAAATC
CTGGCTCCTGGTCCTAACGGATGGCTTCAATCTCACCGAATCTTCGAAATACACATTCTTCATACTTTTCTTCGATCGTCTGTGCAGTTTGTGACGAGCT
CGCCTTTGCGATCAGATAGCCTGAGAACAGATCGACCCACAGCAACAACTCTGTATTTCTTTTAACGATCGTGGTAGAGACAGAATGTGATTCATGGCCA
AAATTTGAAATGGGTAAGTCTCTTGTATGTTTCCTGGCGACCCACCCGATCATGCGGGCAACCCTTGCCGGTTTCACAATTGACGCACTCGCCTATATAG
CGCTGCACTCTTCTGTACAATCTTCTCCAGTGGAAGTTTATCCTAATCCGTTGATATGTGCGGCCTACTCCTTGGTGCCCGCCGTCCAACCTAGTATGGT
AATGATGTACGACATCTCGTTGCAACAACTCGGGAATTACCAGACGAACCGACTCACCACGATCTTTGCTTTTTGCTGCTGCCCTAGGACAGGAAAATGA
AAGTCCATCTTGGTCGACTTCGTAGTCCGGTGCGATTAGGGAGCATCTTTTTGCCTCTCTAGCATTCAGCATGGCTATATCCCCAATCAGATACGCTTTC
AAGTCAGATATCCAATTTTCCTCATCTTGCGCCTGATTTATGTGCTCAATCCAGACCTGTTGTACAATTTCTTCTTGCAAAACTGCCGGGTAACATCGTC
TTCGCGTCGTTGACCGCATGATAGTACCTTGACTGGGAGACAGGCTTGTCTCGGTATCAGTAACTCATTCAACCGATTAAGCGTCATGAGATTGTTTTGT
TCCTGGTCTGATACCACGGCGCCCCTCTTCTCCTGCTGTAGAGCTTCGCTCGCTAGCTGATCAGCACTCTGGTTCCAGTCCCGTTTCATATGTAGAAATT
CGTGCTTTGGCCATGATCGGAGTTTCTCCATTGCCATATACCGCAGCAATTGCAAAACTGGTGCCTTACAATCAATTTCGCCCCGCATCTGTCTGATCAC
CAAGTTCGAGTCACCACAAAAGATCGCCCACCCTTTAGCCTGATTAGCCAGTAAATCAAACCAAGCAATAGCCCACGGTATTCCGCTTCATTTATTGTCA
AATTCTCTGCAAACTCGGAAATAGCAGCCACGATCGTCCACTCAGGTAACTTCCATAATATCGCACTGTAGGCGACGCCCTTGTTCTTTACCCTAGCCGA
TCCATCAAAAATGAACACCAGGGTTCGTCTGCTTCGACCGTGGGTGGTAGTATGCTTATGGTTTGCCGTGGCTGTTT