Description :
From Genome Similarity Track
Location :
scaffold_217:41697- 49886
Transcript NameFunction/comments
g5832.t1hypothetical protein
g5833.t1hypothetical protein
g5834.t1 maleylacetoacetate isomerase
g5835.t1hypothetical protein

Sequence
8189 bases(100 bases per row)
AACGTCTCGTTATCACGATGGGAGATCGCTTTAATATCAATCCAAATACTCCAGGGACTATTATCTCTACACCGGAAGCAGCAAACGTTGGGTGTCTGTT
TGACAAGTAAGAAGGTCATGATGGGCGGATCCAATGGTATCAAGCTGCGTCGATTTGGACTGGAACTGATCCTGCGCTCTGGCAAAGCTCCACATCAACT
GCCAAGTGCCGCTCTTAAGACTGTCTACGAAATGGCCCCTGAACCTCGCTCCGCAGTAAAATCGTCGATGAATTGCAGCTCTGTTTCATCACCTGGTTCG
TGGTCTCCTTGTCGATTGACTTCGGAACTTGGAACGCCAGCTACATCTGGCTCAAATTCTCAGCTTGACGAGTTTACGACGATAGCACAAGATCTTTTTG
CGTTCGGAGTTCTTCTACTGGAAATGTGTACGAACGAGAAGCCAACAAACGAGCTATTCAACCGCATCTCTCTCTCCAAGCAGATCGACCCAGTGTTCTA
CGATATTTTGGAACTGACGCTGTCACTGGGTGGTGTTACAACGCTTGAAGCCCATCGGAAAAGGTCTGCTTGTGTTACAACGGAGAATCTATTGGATCTC
CTGGTTGCAAATGAGCAGCGGCGAGCTGTAGAAGAGCTGCGGCTATCATCGGCCTCATTTCCCTGTTTCTTGCTTGCCGACCGGTACTTCATCACTAAAG
AGATGGAGCAAGTTGAGGCAACATTAAGAGAACGGGATCGCCGAGGTGAAATCGATTTAAAGCGTCTCGCTGCTGTGGAGCAAGAGCTCATGGACGAGCA
GAAGAATTTCTCCATTCTCGTTCTTCAGCTGGAACAAGCTCAAAGAGAGAACGCACTGAAAACAGAGGAAAACTTGCAGCAGACGCGTTTAGACACTTAT
GAGCAGAGAAAGCTGGAAAGTGACGCGGAAATAGCTCGTCTCGAGGCACAAGTTCAAAGGCAAGCAGAGCAATTAGCAGCGCTGCAAACCTCTCTGGATA
AAGAACAAGGGAGGGTGAAGACTCTGCAAGTGGCGAGGGCCAGCGATGCAGAAGAGAAGCAGGGTCTTCTATTTGAAATTCTTAAATTGAAAGAGGAGAA
GCGGAAGGTTACAGCTGACAAGCAAGCGGTGGAAGCCGACTGTGAAGCAATTGCGCGTAAAGTGGGTGGTGAGAAGGAGGCAGTTGAAGATCTTGAGGGT
CGGCTGGCTCAAGCAATTCACCGCTGGGAAGAAGAGCAACGGATGCGAAGGAGAGCAGACAGACAAGCGGAATGTACGAGTCTTCAACTGCTACGAATGG
AGGAGGAGCGGAGTAAATATTCGAGTGTGTTACAACAAAGTCCTACGGGAAAACGCGGCCCGAAGGCCTCGCTGGCGCATGTGCTGGAACTAAAGGACAG
GGAAATCGAAGAGCTCTGTCATCAACGCCAAGAAAGTATTAACGACCAGACAATTTTACTGTCAGATATCGCTCGACAGCAGGCCGAGTGTGTGGAGCTT
CGTTCAGAGAGAGAAGCACTACTGGTGCAGCAGGCGAATACTCAGAGCGAGCTGCTGTCGGCAAATTCTCAGGTAGAAGAGCAGCAAGGAGTTATTACGG
GGTTGCACGAACAACTTCGACGTGTCAATAGTGAAGTGGAGGCTTTAAAGTCGAGAATAAATGATTTCGAGGAGGAATTAGAGCGCCAAGCGAAGAAGAA
AGCGGATGAAGGTAAGCTTTAGTCTATGACTCCAGCATTTCAACACTAACAGTCGTTGTTTTTTAGAGAAAGCACGCAAGTTAAGACAGTGCTTGACTCC
TCAGTGTGACGCCCCTCAATATCTGGTAGGAGCGTCTGGATATTGTAAAGAGTGTGAAGAGCGTTCGGGTCAAGCGGCTCCGTCATCCATGAAGCAACAA
CGACACCGTCGACACCGCAGTTGGGATGACGCGAGTTTAGGTGGGGCAGGAGTGCGCAAGAACAGCAAGAATATCCCCATTATGAAGCTGGTCCAAGTGT
TTTCAGGTGGGAATGACGACCTCCGAGTCGAAGGTCCAGACCAACAACAACTACTTGAAGCTCTGAAGCAATTAACGCTGTTGCTCAAGTCGGACGAAAG
CTTGAAAGACGACCTTCCTGAATGTCTCGTGATCAAGTCCGTTCTCGCTCTCATGCACCACCAGAAAAACAGTCTCGTACTGCAACTCGAGTGTTGCAGG
TGTCTTAGTGTGGTTGTGTTCAATCACGACCGGAATCGGCTTATCGTCGTAGCAGAAGGCGGCGTAGATCCTGTGATCGCAGCAATGAAAAACTTCCACT
TGGAGGCCAAAATGCAGGAGACGAGCTGCGTTCTGCTCACAAACCTGGCGCACAACTGCGGTAAGAAGATCATTTTGTAGTTCGACAGTAATCGTCTTGT
GCTGACGCGTTTTAACGCATGGCAGAAACCAACCGCCAGCGGATTCTTGACGCTAATGGAATCGACGCAGTTCTGTCAGCTATGCAGACATTTCCTCAAC
ACTGCGGGGTGCAGAAGCGTAGCTGTTGGGCTTTATTAACACTGGCAGGATCAGACTTGATGTGTGACAGCATCGCTATGCGAGGTGGACTCGGCGCTAT
CATTGCAGCGATGCTCAACTGTCCGGCAGACGAGCACGTCCAACATTACGGCAGTTGGGCTCTGGTCAACCTGCTTTCAGGTACTGAGCGTCTGCAGAAT
TTTGCACGTCGTGAAGGGGTCCAGGAAATTGCTCAGGCAGCGCACGCCTGCTTTCCTGAACACGAAGGCATTCAGGAGAAGACATTGGAGATCCTTCGGT
TGCTTGGGTGAACTTCTTTAGGGGTAATTCATGATGCTACTGCTCTGCAAACGAGTACTGAGCACCTTGGAGTAACAGCTCTCCTGCTGTTGTTGAAATA
AGAGTACACTGGGTGGAGAACGAGTCGCCAGGACTGACAGGAACGATTATCTGGCCTTGAAGCCCCAAGAAGATCCCATCCTGGCATGCTGCACCGGCGC
AGTGCTCGACTAGAGCACTCACTTCCAAAGCCACAGCGTCCAATTGTCCTGTAGCGTGGCGATAGACGCGACACCTATCAACAGATCATTGAGCGATTGA
CGTCAAACTAACAACCCGAAAAAAAAACAGGAAGAAGAGATAAACATACCGAATCTTGCTTGGTCGGGCTGTTGGTTCTGCAACTGCAACAGCGAGTACA
ATGCTAGAAATCTGGAGCGACAATCGCAGATGCCTTGTGTCCACCTCGCTGCTGTTCGCAATTGAAAGTAGCCGCTCTGTGGCGATATTAACTTGGAACG
CCCGAGGCTCGGAAGAAAATCCGTTGTCCCAGCGAAGTGCGAACGTTGTACTGGGCCCGGGCTGAGTGACTGCTACAGTAAGGTGATCAGCATTGAGATA
GCCAAAACGTTTACTGTTGAAGTCGCCCAACACATCGGTCTGCCCAGCTAAACGGCGGCTATCTAACGCCTTCCCATTGATCGTGACACTGCCAGAGAGG
TTGACCACGCTGGTGTCCGAGCCAATGTTCACAGTCGCTTCGGATGCTCCGATGCTGATTTCACTAGTCGACTTGTCGCCAATATCAATTTTGGTTGAGG
TCACAGCGAGCGACTCGCCACTGATAGAAGTTGTCCCTGAAAAGCAAAACACACAAATGAGTATTTATCAGCCATCCAAGATTTGACTAATGTCACGCAC
CTGCCAACGACACTGCAGCGCCTTGAACATTGATTTTGTCCACGTTCTCACTGCCAACTGTGATCTCGTCCGCTTGTTCTCCAAGCGTTAGGGCCTCCAG
TGCATCCACAGTCACTGATTTTCCTTTCACTGAAACCTCAGACGCTAAGGACAAAAAATACACGACAATGTATGAGTGAACAACGTCTCCAATCACATCA
AAGCCACAAAACCAACCTTTAGATCCGATAGCGATATTGGAGCTGAAAAGCTCGAGTTTACTTGTAGTAGGGAGTGCTGTCGCGTTTGCTCCCGGTCCAC
CAATGCTCACATGGTTCGCCTCGATAGTCGCAATGCTGGTTTTTCCTTTAGCGCCGACGCGAAATCTCGTAGGATTCACTCTCACAGCAACGTCCGTGAT
AGACAACAAGGAGGTTGTAGTAGAGCTGCCGTTGAAGTGCACCAGACCCGAAACGGTGGTGACAGCTTTACGGTTGAGCGTATTTATCGACACTGAGTGC
GCCGCTTCCAGCTCGATCCCAGAGGATGAGACTTTGGTCACCTGTCCTGAAGTCTTGGAGTCACCAACAACAATCGAAGAAGAGCTTCCGCCAATTGCAA
CACTTTTCGTAGCATCAAGTGAAATTGAAGTACCTTGCACGTTGACAGTCGATAAGCTGGCTTTCCCCACTTGAACTGACGGAGAAGACGCACCCAAGCG
AACATCATTGGAGTTGATGTGCAGCTCTGATAAGCTTATGTCTCGGTTATCAAGAGTAATCCGTTGCGCTGACACGTTGAATCGGCCACCTCCCACTTTA
ACCTGCGTAGTATCATTGACACCACCAGAGTGCTGATTAAACGACACAAGGCCGTGGATGTTAACCTCATGGGTTGGACTGTGGCTGCCAATTTCTGTTT
GTGAAGAGGCAGACTTCTGTAGGCCAGCGTTAATGGTGATTGATCCGTACTCTGATTCTGACCCAGATGCTTGACCTCCGACCAACGTAACATCACCCCC
AACGGTTAGGCCGTCACCACCCACAATGCGGATGTCTCCACCTTCTTTCTGCGTCGAAGACGTTTGCCCAGCCACTTCCAGTGTCACACTCTCGCTTTCT
TCCCCTGACGCTAGCGCCCGCGCGCCATCGTCTCCATTACTGTCACCACCAGGCACAGAAACCCGCACTTTTCCGCCGGTAGCAGTACCAACGAAAACTT
TGTTTGTGTCGAGATAAAGATCCTGGGATGGCGACAAACTCGTCGCATTACCATCGTACTTCAGCGTCACTCCCTTTCCGATGCTGATCAGTCCACGCGT
GCCATCAAGCGTAATACCAGCTGCTGTAGGATCGTCCGCATTTGTGTTGGCCACTGTCACCGTCCCAACAGGGTCGACGAATAGCAGCGAGTTTCCGCCA
GCGCTCGTAATAACAGCTCCTGCTTTTGACACGAGATTCAAGTCACCCTGCTCCTTCACGCCACCTGAACTATTCGCAGCTGTGGTCATCACCGTGCCAT
CGTCAAAAACGACCCCCTTCCTGGCACTCAGATAATCTGCCTCAACCATGGGAGCTGTTGCAATATCCACAGAAAAACATCAAAATGATTAGTAAAACAA
CAAATACATCAGCAAATTCCATGTATACTTACAATCCACCCTGTTCGTGAACGTCACCGTGCCATTGGAGAAGAAAGTCACTCCATAAAACGTCTGCTGG
TCTCCGGAATCCAATGCCCGTCGTCCAATTTTCAGTTCTCCATCATCGAAAGCGATCATTCCCTCCGAATAAGCGGAATTGGAGTATCCTACACGTAGGC
ATCGCCATACAAAAAATTAATTTGTGACTCAAAACAACTACCCCATTACGCCTCCTTACCGCTCTTCAAGAATATCTGTGCGTCGTCCTCCGCTACCACC
GTGAACCTATTATCCACTGTCGTCCCAAAAAGATCGTTCTGATGTGACTCGAAGAAGTCCGTCTGCGTTAAGTAGATCGTAATGCTACTCATGAGTGCGA
AGCTCAGCAGCGTCAGTACTCCAATAGCCGTCCAGAACACATCATGGTCTTCTCTTTTGCGTTTTCTCAGCGTAATTCTCTGCAGGATCCCTCCACTAGA
TCTGTATCGGAAGCTGCGAGTGTCTGCGTCCGAATGGAAGAAGCCTCTTCGCCCCCTTAAACGCCGCAGTCTCTGAACACCAATTCCAGCCATGCGTCTG
GCCAAATCTCCGTCCTCCTCGTCCCCATCCAGCATCAAATGGTCTCCACGTAGATCGTCACCTGGGGAGTCCATGGGAATAGCTTGGCGTCCACGTCGGT
ACGCGTGTTCCTCGCCCTCTGTGGACTGCGTGTCGTCTTCCTCCTCTTCCTCTTCACTTCTGGACGTCTCAAGCGCTTCATTGCCGTCGTCATAGCGGCC
CTGTGCGTCTGTTCCGTCCAGCGTCAGTGTGCGTCGTCCTCGGCCTTCAAACAGCGCAGGGCCAGTGCCCACGTCGATCACCTCGTGGTCCCTGGGGGAC
GAAGCCATCGACTTGATTGCGCCGGTCTCAAGGGATAGAAATAACGTGCAGTTGTGAACACGGCAGATACCCAGTCGGTGGTGAGAGAGGAAAATCTACT
GTTACCGTCTATGTGATGTGGCTTACATCATGTTTCCGCCGATGCGTCTAATCAAAAGGCAAAAGACGCATGACGTTGCAGTTCACGAGCAGCTCATTTA
ACCTTTTGCCTTCCTCATAGTTAAGCATGACGACGAAAGAGCAGTACGTCTTGTACTCGTATTGGCGCAGTAGCTGCTCGTGGCGTGTTCGCATCTCCCT
TGAGTGGAAAGGCGTCCCGTATGAATATCGCGCTGTGCACTTGCTGAACGAAGGTGGCGAGCACTTCAAGGACGCGTTCACGGAGCTCAACCCGAACCAA
CGTCTGCCGGCCCTCGTGGTGGACGGCCGAGTGTTGCCCCAGTCCAGTGCAATCCTTGAGTTCCTGGAAGAGACGCACCCAGAGAAGCCGCTGCTGCCGA
GTGACCCGTTCGGCCGTGCCCAGGTGCGCAACCTCTGTGCCATCATCGGGTGCGACATCCAGCCGATCCAGAACCTCACGGTGCAGGTCAAGGCGACCGA
GGACGTTCCAGAGGACCAGAGACTTGTAAAGAAGCAAGCGTGGAGCAAATTCTGGATCGAGAGGGGCTTTGAAGCTCTCGAGAAGGAGTTAGGCAAGACC
GCTGGAACATACTGCTTTGGAGACGAGGTCACGCTGGCGGATCTGTATCTGCAGCCGCAAGTGTTCAATGCCCACCGAGTCGGCGTTGATATGAGCAAGT
ACCCGACCATTGTTCGCATTTCCGCGGGCTTGGAAGCTGTGCCAGCATTCCAGAAGGCCCACCCGTCCCAACAGCCTGACGCAGTTAAGTAACCCGGTAA
TGAAGCACACGTTGTGCTTTAAAGTTTGTCGTATCGTCTATTGAGATTGCTTGAATGAGCGAAGCTTCTCCTTGACTGCCTTCATGTGCTTCTTGATGGT
CCTGACTTGCTGTTTGTCTACTTCGCTGCGGTCTTTCTCTAGAGCAAGTGCGACATCCATCTCTTTCTTCAGCTTCAGGTACTGCTCCTGAGGTAAGTTG
TCTCCGAAGGGCGAACTCATCAACAAGTCGGCATCGACGCTCTTTCGGAGCGTGCGCAGTGTGTTCGCGAAGTCGTGAATGCAGCGCTGGCGACGGTAAT
TAAACCACGGCTCGAAGTGAGGGCCTTTTACAAACGCCGTGTATAAAGCCTTCCATTTGGACTGCTTGATTTGCGGCGGAAGCTTCCGTGCCTTGATACT
TGAAAGCAGTCCCGGAAGAGTAAAAGGCTTCATATAATCTTCTGCACTCATGTACAAATTTGACCGTCTCCCGCTTGCTTTCCAAATCCCGAAGTACTGT
TCAAAAGGATGTAAGAAATCCTTCGTGAGCTTTCGGAAGTGCTGTATCATCAAACGGTCGATTTGATTAGGAACTGACGCCAGACAGCAACTACCGTATT
ATCAATGAAGCAACGTACCTTTCGAAGCACTGCATTGTTGATAGTGACGTATGGTTCTTCTTCATGGCTGGTAGTCTGGGTAATGTGAACCTCCGGAGGA
GAAACAAGCTGGTGAAGAACAGCGACATCTGGAACCATGTAGCGTGGGCAACGCCTTAAAAGCTGGGGTGTGCAAGAACGAAATGCGTCAGTGTACGGAG
CCATACAAATACTAATTCTCAGCGCTTACCATGGGGCGATGACTGTTTTCAAAATCATCCAGCTCTACGTTCTTCTGAATTCGAAGACAAATAGTTCCTG
CCTCCTCCGCCTCGGCATGTTCAGCTACGGCAGCGCCTGAAGTAAATGGCAAACACATTACGCTGATGAGATGACACTTTAAAACGAGATAAAAAGAATA
AACCTCTCAGACGTTTTCCTTGCTGTGCGTTAGCACCTGGAGGTTCTAGAAACGGAAAGACCAGTGCGTTTGGCCAGTGGCTCAGCGAC