Description :
From Genome Similarity Track
Location :
Scaffold_30:416966- 420569
Transcript NameFunction/comments
Physo_156888hypothetical protein
Physo_156891hypothetical protein

Sequence
3603 bases(100 bases per row)
GAATCCCCCAGCAGAGGCTCCTCCATGTCGCTGACCATCATCGTAGCTGTCGGCACGCGCGCCATTTCGTTGTATCGCCGCCTGTGGAGGCAGCAGCGGC
GATACAGGAAGCAGAAGAGGTACGAGCTGCACAGGAAGATGGCCACGAAGCACACGAGCAGCGCATCCGCCCACTGCATGCGCTGCGGCCGTGCGGCCTG
CTGCAGCGAGGACGGCGCATCCATGTCGATCCACATCTTGAAGCGCACTTGTTTTTTTAATTTTTTGTTATGGTAATAGTATTTGGTCAAACGGACCAAA
TTTTGGTCCACATGATGACTTCAACTACTTGTACTGCTTCATAAAGTTGATGCACGATATTACCACATATCTCGTAAAACTACGCAGTCGTTGAGCAGTA
GCACAACCTGTGACTCAGCTAACGGGCTGGTTCACCGCTTGGTCCATAAGCGAGTTCTCGATGAGCTCCTGGCTGGCCGTGATGCTGTTGGCAGCAGCCC
CCATCATAAACTTGGTCATAGCCCCCATCACCGGCGAGTCCTTTTCTGGCTGCTCTTGTCCGTGTTCGAGTGACACCAGCGAGCACATTTGGAGTAGGCA
GCGCTCGCCAACAGATTGTGACGGGGGGACAGATGATCGCTTGGCCACGGCGTAGCATTGATGGCGATGCGTAAGGCCTGCAAACGGCTCGTCCACAACC
TCCAGTGGAGTTTTAATCGAGATGAACACAACCACCACGCGGTCCTCCTCCACATAGCGGCGCAGGACTTGCTTCACTCGGAACATGGCGTGCGTTGATC
CAACATACATCTCCTTCGCAAAATTCTCGACAATCGTGTCGGATTCGTCCAAGACCTGAAGCAAAGATAAAACACAGCGTAAGCGAACACGAAATATTCT
GGTACAATCAAGTTCTAGAACGGGAACTGTACCTTGGCAGTCTTCTCATACACCTTGCCTCTGTGTTTGTCGGCGCCCTTGAAATGATCCCACACTGCCT
TTGCTGTCGTGTCCAGATCGAAAGGTAGCACTTTGTTCGAGAAGACATCCAGATAAATACCATCATCTCCCTCGCGCACTTGAGTATCCTTGTACGTAAC
CTCCATCGAGTTAAGGCCGTTTGTGCAGAAGACAGCATCCATCTCACGGTATGCTCCTTCAAGAATTACGAGCATGTCTTCAAAATCACCGAGGTCTGAA
TGGTAATTCACCATGCGTCCTGCCGCGAAATCGGTCGTGTCAGGTGTCACTGTTCTAGCGCACTCCATAAGCTGTACAGCAAGTAACCAATGCAATGAGT
CCACGTCAGCGACAGCCCAACAATGGTAAGTACAAGATGGCCATGTACCTGGTTCTTCGCACGTTTGAGTAGTAGCATCTGCATGCTCTTGGCAGCCTTC
AGTTGGCTCTCCAGCACAAGTTTGAGGCGTGCATTTTCGATCTCCGCCTTCTCCCGACGTTTCCGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTCCGCCAGGAACGCCATGCTGCAAGCTCCGTCGACGCTTTTCAACTGTGCAGCGCAGGTGCGATTTTCACCCAATTGTCTT
GAAGCGAAGAGCGCGCATTGAACTTGAATTTGGTGTACGACACACCGCAGCATTTTTCCTGAAAAGGCATCAATAATGTTGCTGCAACAGGGAGGAACTG
CTCGACATTGGAGGCAGATGAGAATCAAAGCAGGCAAAGAAAAATCGCTGATTCAATCCCAGGAGCCGTATAACCTTCACAGCGGCAAATTGCAGGACGT
CGCAGATCTGGTGACTGCAGTGCCGAACAATTTGCTGCACAAGGTGTAGCCAGAGTCAGGCATGAACAACGCTGCTCTTATCTTCAAACGCGCTGCAGAG
GATGGCGAGTTACGTAAAAGCTTCGCTGGCCAAGTAAATGGCGGGGTATTGTACTCGCCGTCGGTGTATTCTTACAATGATTTAGTGGTGCCACCATGAC
CGTGCATCGGGTTGCCGACTTTGCCTGTAAGCTGGTGCTGCTATTCGCAGGCTTATTCTAAGCGTGCTTTCCGGGAGTGTTGCCCGGAGCTGGTAACGCG
AACTTCGGGCAGACTTGCTGTGTCTACGCGAAATGCTCGTAAAACTTTCCTGAATCTGTACGCCAACCACTCTCACTTCATTCCCTGTTCATTGATGCTT
GCATGTTGTCACCAACAAGGCAAGTGCAGGCTAACGTACCGTCGGCGCCGCCGCGGAGGCAGCAGCAGCAGCGTGCAAGAGTAGCTTGTGAGTGAGGATC
TGGTTAGAAGGAGATCGAGGAAGTTGCTGTGCTTGTGTTGCCGACAAGTTGTGCCCAAGTTGCTTGCTTGCAGTTGAAGCGCTTGGTCGGCGGGATCAAC
CAATCAGGGTCTTGATAGCACCATGTGGTTTTGCCACGCAAGCAAAAGTTCAGACAGAGCACACAACTCAAGCGGTGGTACATCAGCCGAGTCGGGGGCG
TCGAGGTGTGTCCAGGGCACCCCCGCATTGGATCCAGCAATGACAGCAGCAGTCATGTTTGCGGGCGTGGACATCGGAGGCACGGGCGTCAAGGTGGGCG
TCGTAACGTCTGAAGGCGTCGTGGTGGCTCGCGAGCAGGAGAATTACCACCCAGACAGGCACGAGCCGCAGGACGTCGTGGATCTGGCCGTCTCCGTGCT
GCAAAAAGTGCTCAGGACGGTGCGTGCTCGTGCGGAGTTGTGGGTGTACTGTAGCAACAAGTATATTATCAGACTTCTCACTAGTCGTGCACCTGCAGAC
CCACTTGGGATTGGGAGACTTGGAGGCTGTTGGCGTGTGCTGCCCCGGTGTACTGGAGGCTGGCGGCGTCATCCACGCAGCCGCCAACTTTCCGTCCTGG
TTGGATGTGCCGCTTCAGCAGTTGTTCACAGACACCCTGGGCAGACCGGTTGGTAGATCCTGTTGAATGTTTTATTTTGTGGAGCGGGGAGTGTGGACTA
ATGTCTTGCCTTGCTCTCTAGGTCACGGTGTGCAACGATGCGGACGCTGCTGTCCTGGCAGAGCAGTGGGTTGGCACAGCCAAAGGTGGCGTCAAGGACT
TCATCATGCTCAGTATGGCACGGCTGCATGCGCTTATTGATGATGGTGGTGGATAGCTGACGTTTGGGTATTGGTGCTGTGCAGCCCTCGGTACCGGTGT
GGGCTTCGGGGTCGTCGCGAATGGCAAGTTGGTGCGAGGAGGCAGCAATGCCATTGAAGGGGGGCACATGGTAAGGATATGAGAGGTGCCATTATAGTCG
TTTCTGGCTGCTGAGTTGTGGTTCCTGGTGGATAGATCGTGGAAAGGAATGGCAGACCGTGTGGTTGTTCTCAGAGGGGCTGCCTTGAAGCATACAGCTC
CGCTGGTGCGCTGATGGCGCAAGTTCAAGAACACTTACGTGCAGGTTCGTATTTTCACGGTATGTCCGCGTTTTCGAGGGCAGAGCTCATCTCATCACCT
TTTTCGTTTTAACTCGTAGGAAGGGACTCGAGTCTCGCTAATTATTCTGAAGCGGATATCAATGTCGAGTTCGTGTTTAAGCATGCTGCAGAAGGCGACG
AGC