Description :
From Genome Similarity Track
Location :
contig_100:41677- 43105
Transcript NameFunction/comments
g11022.t1hypothetical protein

Sequence
1428 bases(100 bases per row)
CCTCCGACGTTAGCGTCGGAAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTTCGCTCGCGACCTGCACGACGGACGCATCGAGCAGATCTGCAT
CCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGGACCAGCTCATCTCTGAGGGCACGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGC
TTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACC
GCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTATTGCGTCACGCGACAGTGGCCATTGCCGCGTGAGCAAGCCAAGGCGATC
AACGACTTATTTGAAAATCGTCGCAAGGCAAGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTCAAGAAGACACAGGGCAGGT
GGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAAATGTGATCATCGATTCGATGACCTCGAG
TACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATG
CTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCGACTTCGCACCGAGCTATT
TCGATGATGTGTTCATTCACAGCCGGGCTGTGAATGGGAGATCGGATGTAGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGTA
CAACCTCTACGCAAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTTGGGAAGAACGGCGTACGCCCTGACCCAGGA
AAGATCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAACTGTGGCAGTTCCTTGGACTCGCCACGAACTTGTGCAAGTACGTGAGCAACT
ACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTGAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGG
CTTGACTGAGGCGCCAATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAA
CTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCA
TGAAGTATGCACTCGCAAAGTTTCGAGT